Description :
From Genome Similarity Track
Location :
Scaffold_23:662726- 664146
Sequence
1420 bases(100 bases per row)
TTTAATGATCAATTAGCAGAGTTGTTTTGTTGTCGACAGTTCAAAACCTTGCATCTGTACCCCGCCATTATTTCGAAGTCTCGTTTCCAGATATCCCGAT
CCCAACAAAGTAGCTTATTGAATATTCGTGACGACAAAACTGGTAATATGGCCATTGTATTGAACCTAGCAGTTGGGATGCCAGTCCAGTGCACTATAAA
TGTGAGTCGAGCACTGGAGCTAGCCAATGGTACAATCGGCCACGTTATCTATATCCAACCAGACCAACATGACACGACTCGATTGACGACGCGAAAGATT
AACCCCTTAGTTCCCGGCCTCAAATATGAGGGTATATTTTGACCTCGTCCCATATACAGATATAAAGGAATTTGTATGGGGTTTCAATTAAGTCCGGATA
TCTTGGCGCGGGTTCGGGGTGGTAACAACGACTTGCCAGTGTGTATAGTACGGATTCTCCAACATAAAGGAGGGTTTATGTAGTACATTAAGACGATCAT
ATACAACTATGCTGTATAAATAAACATAAGATATGTACGGTTTATTGATTAGCCTATCTTTGTGCTGTTGCATACGTCCAGCAGCGGTGAGTTCATTTAT
TATAGCCAATAACAAGAAAGATCAAGTGCCGTATCAATTGATTGCCCCTTGCATAGACATGTACGACCAGACGGCGCAACCACTACGCCTCCTCCTCCAC
CGCTTCATCATCTTCTTCGCTCGACTCCCCAGCACCAGCACCAGCACTTGCTCCGCTCTCGCCTACCTGCTGTCTGCGTCTCCGCTTCTTGCCTGGCCGC
GACGCTGGCGGTCGTTCACGTGTCCTGTGCTCTTGCAGTAGGTCGCGCGGGATGTCGTTGCCGTTGTTCCAATCAGCATGCCAAATGCTGCTGACCCTGC
CTTCACGCGGAACGTTGCATAGGTATTTACTAAATCAAAACGAGTTAGCCAAAGCTTACGGTAAGGGTACCAAGCGAGCTACGCACCGTTTGTTCCCGTT
CGAGCACTCCGGGCAGAAGTATTTCGTAAACTTGCGAGGCTTGACCTTGTAGATGGCATAGACTTTGCATGATCGGTGGCGTCGCTTCACACCCTGCTCG
CAATCGACAGTATCTGGGTTTTCTTCTAAACAATGTCCGTCGATAGCTGACGATGCGCTTCCTTGTAGCTGTGTTGAATCTGCTCTTGCCGGCGAAGGGG
CAGTTCTATTTTGCGCAGATGTCGCTTGCTGTTCCAATACAGTCAAGCCCACCATAAGTTAGTTGTTATGTTGGAAGGCTGCTGAAGCAGATGAGGTTAT
GTTGACTGGTCAACATTTGACTTACCTCAATCTCGTCAAACGCTTCGATTGAATCTACTGCCAGTAGCTGCTCCATCAATTCCTCAAAAAACGAGAAGTG
TTTTGGCGGGCGCCTGTTGT