Description :
From Genome Similarity Track
Location :
Scaffold_128:66258- 67355
Transcript NameFunction/comments
g17160.t1hypothetical protein

Sequence
1097 bases(100 bases per row)
TACCGTTCAGCTGCTCCAGCGCGAGCATCAGCGACTGCGTGCCTAGGCGACCGTGTCCTTGGGCCTTGACAGCAACGTACAACTGGTTGGCGAGGGCGAG
GCCGGGGAGCGACAGGTTCATGCTGATTGTATCAATAAACCAGGTCAGTAAGTAGGCCAACACCGTGATCATGCTGCTAAGTCATACCTTTCCGCCTCCT
TCAGGGCGATGCCCATGTCCTTGACAAAGTGCTCCACGAAGAAGCCCGGGTCGAAGTTGCGCTTCGCAATTCGAGGGCCAAGGTTACTGATCGACCACGA
GCCAGCAGCACCTGCGCTCACAGCGCGGATAGCCTCTTCCACATCGAGGCCGCTCTTGTGCGCGTACAGAAGGCCCTCCACGACGCCAATCATGTTGGTG
GCGATGAGGATCTGGTTCACCATCTTGGTGTGCTGACCAGCGCCAGCGCCACCCATGTGACGGATGTTTTTGCCCATGATTTCGAATAGAGGCAGCGTCG
ACTCCACGGTGCTGGTATCACCACCGACCATGATAGATAGCGTGCCCTCGCGAGCGCCGATATCGCCGCCCGAAACAGGGGCGTCCAAGCTCGAGACGCC
CTTGTGCTTGGCAGCCTCGTAGATCTCCTTGGCGAGCGACGGCTCGCTGGTAGTCATGTCCACGATGACGCTGCCGGGCTTGATGGAGGACAGCACGCCC
CACTCAGGGTCCAGGAACACCTTCCGCACGTCGCTGGGGTAACCCACAATGCCGAACACGATGTCTGCACACACAGCACCAACAACGGTCAACCTCAAAG
TAGGCACAAAGGATACAAATACTGGTGTGTAGCAATCAACACGAACCGGAAACTTTGGCCACCTCGGCGGGGGAAGTGGCCACCTGCGCGCCCTGCTCCT
TGAGACCGTCGCACTTGGACAGCGTGCGATTGTACACCGTCACCTCATAGCCGAGCTTCTATTCTCCGCACAAGCAGTCCCAGCATCAGCAACACAGCCC
TCGTTGTCTCTGCAACTGCACCCAGCCACTGCAAGACGTACCAGGATGTGGCCGACCATGCTGGCGCCCATGACGCCCGTTCCAATCCAGCCAACTC