Description :
From Genome Similarity Track
Location :
Scaffold_13:662565- 666773
Sequence
4208 bases(100 bases per row)
TGATCTCTAGTGGCAATGCTCTACCACCACCTGCGTACGGTGTAGTGTGCGACATCGATGTACAGGGCCATGCGCCTATCAAGCAACGAGCACGGAGGAT
TCCCCTCCGACACGTCAAGAAGCTGTACGAGCTTTTGCGAGGTTTGCTCAAGGCCGGTCTGATCGCGTTCTCCAACAGCCCATGGTCGTCACCGATCGTG
ATTGTGCTGAAGAAGAATGGCGTAGATATCAGACTATGCATTGATTACGAGATTGTGAACGCAGTCACCGCTATCATGGAGTATGCAATGCCCTTTGTGG
ATGATCTGCTCACGGACCTGGAGAAGTATCTGCGGTACAGCTCGCTTGATGCGGCGAGTGGGTTCTGGGCGATCATGATGACACAGAGGGCTCATCAGAT
CTCTGCTTTTGTGTGTGCACTGGGTCATTTCGAGTGGCTCAGAATGCCCTTTGGGCTTAAAAATGCACCTATCATCTACCAACGAATGCTCGACAACGCT
CTGTGGGGCTTTGTTCAGCCGAAGGGTGGCTGGAAGCATTATGCGCGTCTGATGACAGAAGCTGAAGCACGCGACCGTGAACTCGCCGACGCCTCGACCG
AACAGTCACATGAAGAGTCGTCCGACCCGGACCAGTCGCCTACGAAGTTTGAAGCGGGACTTGGTATCTGATCGAGTGAAAGCTCGGTCTCGGAATTAAT
CAACAGTCCTATTGCGGACATGTTTGCGAATGGAGAGCCCGACGAGTCTTCGTTGGTGCCGGTTTTCGAACGGCGTTCATTTGTTGACGATATTTGCTTT
GGCGGCGAGTCTTTCGATGCATGTCTAGCGACGCTCGATCGACTCCTCGCTCGGTTCGAGGAATGTCGGATCAGCGTGGGTTTCACCAAGAGCATTTTCG
TGCAGCCCAAGGTGGACTTCCTGTCTCACGAAGTGTCCCGGAGTGGTATTAGAGCAGACCCTAAGAAGTTGAAGGCTATCACCGAGCTGTCCTTCGCCAG
GTCCAAGAAGGGAGTGCAAGCTTTCCTTGGCGCTCTGAACTACTACAGTCGCTTCATACAGGACTCTGCTGTCTATGGTGCCGCGCTCGACCAGCTGCGA
GACGAAGACTTCGCACCAGGGGGCGACCTCTCTGCAGCCAAGCGAAGCTTCGCAGCATTGCAACGAAAGGTCGGTGAGGCACCTGTCCTCCGACACTTCG
ACCGTGACCGGGAGGTCCATGTGACGCTGTTTGCAAATAAATGGGCAGTGAGCACCACGCTCATTTAGGAGCACGATGGCCTGATGCACCCGGTGCGTTT
CTGCGGCCGAGTGCTCAAGGACGCCGAGATGAACTCCCACCCGGCGGAAAAGGAGGTACTGGCTTTGCTGCAGCTGTTGAAGGTGTGTTACACCCAGCTG
ACCGGTCGGACCATACATGGCTACACGCGGTTCTCGACGCTCGACTGGGTCCACAAGTCGAATACACTCTTCGGACGCGCAACGCAATTTGCCGTCTTAC
TGTCTCCGTGGAGTCTAGTGGTGCAACGAGTCAAGGAAAAGGATTGCGCCTTCGCGCAGCTCTTACAGTCGACGATCACAAGCTTCGTTGACCTCGAAGC
CTCGTTGGCACCAGTGACCCCTCGAGCCAAAGGATCGCCGAGTGTTCGGATGGATCGGCATTTGATTTATGCACGGTTGCCACGTACATACAGTGGCTAC
GTAAATTTCGTTTGATGGCTCGGCGAAGACCGAGAAGCATGGTGGATACGGCAGTTGCGCCTGGATACTATGGCGACTTCCTGAATGGAGTGTAGTGGTC
GCTGCGAGTGCGTATCTCGAGACCACGACTGTAAACCTCGCTGAGTACACCGGAATGAACAACGGGGTCTCTGCCGCCCTGGAACATGGGGCCGAGGACT
TAGTCATCGTCGGGGACTCGAGACTCGCAATCCAGCCATCCCTAGGGGTGATCGCTTGCCGTAAGGAGTCGCTGATGGCACAACTGAATAAGCACAAGGA
ACTGACCGCGAGATTTCGGTCCGTGAAGTACCTACATGCTATCCGAGAGTTCAATGCAGCTGCAGACTCTTTAGCGAGCGAAACGTTGGAGAAGAAGGTG
TCGACGACGGTGAACAGCGAAGACCGAAAACGAGAGTTGATGGAATTGAATCGGATCCGAGAAGTGCTCTATGAACCGTCAGCCGAAGCCTCCGAAGCTT
CTGGAGAAGTTGCAACGTGTCACGTGAACTCGATACGCGTGATGTATACGCGTGACAGTGACCGTAGTAAGAATTTTTCGATTTTGTACGGGATACTGGA
CATGTAGCCGCGGTAACGAGGCAACAAGCCCGCGCGCGTGCGAAACAAGTACGCTTTGCCGATGAAACTTCGGGTGATGAACCAGAAGAGAGAACAGAAG
GAGACGAAGCTAACGACGCCAGCAACGAAGAGTCTAACGAACTTCCGGACCAACCGAGACCTGACGCAACGGTGGTCCATGAACCGAGTGCTGACGACAT
CGACCCGCTAGTTGTGCAGGAAGAACGGCGCAGGCGCATTGGCACAGCCCAGGATGAGGAGTTCCGGTGGTCAAACCTCATAACGCTGCTAAAGGGAGAC
GAAGCGAAGCTTACCTACAAAGCTGCACGCGAAGCCTGGAAGATGGCTGACAAGTTCGTCTTAAGCGAAGATGGCTTGCTGTATTTCCTTGGTGCGAATC
GTCGGTGGGGTCGCGACCGGGCCGAGGAGACGACACTACGCCTAGTCGTGCCAACAACGATGGTTCAGGAGATCCTACAGAACTGCCACGACTCGTTGGA
GGGCGGTCACCAAGGTATCGTCCGAACCTACCACCGAGTCAAGGCTGACTACTATTGGATTGGCTTATTCGCCGATGTGGAGAAACACGTACGCTCGTGT
CCAGACTGTAGCTGAAGCAAGAGTCGCCCGCAGCTACGTGGGTACTCCCCAGGCAACATTCTGGCCGAGCGTCCGCTACAAATTGTCTCGATGGATTTTG
TGATACCCCTACCGAAGACTCGGCGGGGCAATACCGCACTGCTACTGTTTCAGTGTGCGTTCACTGGATTCGTCATGGGCAAGGCGATGGCGGACACATC
TGCACTCTATGTAGCACAAGTATTCGAAGAGTGCGTGTACCGAAGGTTCGGAGCGCCGTCTCTGATCAGGCATGACCGAGACCCGCGCTTCATGAGCGAG
GTCTTCCAAACCTTCGCCGAGATGATGCAGTCGAGATCTAGGGCTACGTTGAGCTATCGGCCTCAGGCTAACCGCCAGCAGGAACGCTCGGTCAAGACCG
TAATGAAATCGGTGCGAGTGTACGCGGAGGACCCACTGCAATAAGACTGGGATGAGATTGTGGAGAAGTTGATCTTTGCGATTAACAACTCGCAGGACGC
CACGAGGAAGGACACGCCCTTTTACTTGGTGCACGAATGGGACGCAAGGTCCACCCTCCGAGCAATGTCCTCATCACTGAAGCGAGGTGTCGGGCGACAG
TTCGATGCGTTGTCACGGCGCAGAGAAGTCAACAGGCAGCAGGGAGTTGCGTTGGAAATGGCTAAGGAGTACCAAGCAGTCGAGAAAGCTCGGCGTGCTC
AAAAACATAACGAGGCTTTGAGCCGAGCAGAACGTGCTGCGCTTCCACCTTCCGCGACTGGCGAAACCTCGGAAGATGATCCGACAGGTGCAGAGGGTGA
CACACCAGACCCCGCACCGAAGTCTCTCTCCCAGCCTGGTGATCGCGCGTGGCTTTAGATGGAGCGCGTCAATCCAGGATTGACCAAGAAGTTGGCTCAT
CGATGGCATGGTCCCTTCCGCATCAAGCAGAAGGTTGACGAGTATGCGTACGAGTTGGATTTGCCTGACCAGAGTGGTTACCGGTTCTACCCTGTAGTGC
ATGTGTCCCGGTTGAAGGCGGTGAACGAGTTTGGTGATCGGCCGAAGGCTCGACTTGCTGCCGAAGTAACCGAGGAGACGCGACTGGATTTCGACGAGGA
GTCACTCCCGGAGGATAGTTAGAAACCCGACCACCTGGTAGGCGAGTATGAGGTTGAAGCCATCTTGGATGACCGAATTCCCCTCTCGACGAGCACGGAG
CGAGCCGTCCGAGAGTTCAAGGTGAAGTGGGTCGGCTATGACGAACCCTCGTGGGAGCCCGCGTCGAATCTGTCTTGTGGCGTACTATCTACGCGAGAAA
CGACGTGA