Description :
From Genome Similarity Track
Location :
Scaffold_64:66244- 68143
Transcript NameFunction/comments
Phymu_g3208hypothetical protein PHYSODRAFT_479774

Sequence
1899 bases(100 bases per row)
GTCGAGAACTTGGATGCACTCACGCACCTGCATGAGCCGGCGTTCGTGGACTATTTAGCGCAGCGCTACGGCGTAGATCAGGTCTACTGTCGGTCAGGTG
CTGTGCTCATTGCTGTGAACCCGTTCAAAGACATCGCAGGGCTGTATGATCTAGAGAAATTCCACCAGGATATGCCCAACTGGACAGCGCTACCCCCTCA
TGTGTTTTCCATTGCTGAGGGGGCCTACAGATCGCTACGGAGACGACTGCGCGAGCCTGGAGAAATTAAAACGAATCAGACGATCCTTGTCAGTGGGGAG
AGTGGGGCAGGGAAGACAGAGACGACCAAGTTTATTATGAATTATCTAGCGGAGAGCAGTCGGGAtacaaccagcagcagcaaacggaAGCGAGCGATCA
GCGGCAGTGAACTCATGAGCGCGAATCCGATCCTGGAGTGCTTTGGCAACGCTCGGACACTGCGGAACGATAACAGCAGTCGATTTGGGAAGTTTGTGCG
CATGTTCTTTGAGGGACACGACCTCGGCGCCTCGTTGCGGATGGTGGGCACGTCTGTGGAGACGTATTTGCTGGAAAAAGTGCGTGTGGTGCACCAGAAC
GACGGAGAGCGGAACTTCCACGTGTTCTACGAACTGCTAGCAGGTGCAGACGACGAtatgaagaaggagctgcatcttgaCAACATCTCGGCGGAAGAAT
TCCAGTATATTAACGGTGGTCAGTGCTTCCAGAGAAACGATGGCATCCAGGACGacaagcagttccagttggtgctgcagtcgatgaAAGTTTTGGGCTT
TACGGATGTCGAGCAAGCAGCTATTTGGAAGATCCTGGGCGCCTTGCTGCACCTCGGAAATGTGTTGTTTGTGTCTTCGtgtgacgacgaggaagaggat
aATGGAACTGCGTCGTCGCCTTGCCAACTCGCATCCTcctcgccgtcttcgcttACAGTACAGGGCCATCTGGATATCGTATCGAAGCTGTTTGCAGTgg
atcaagaagaactggttTCAGCGCTGACTACGAGGAAAATCAGCGTTGGAGGCGAAACGTTCCATTCAAATTTGAGCCTCGCGCAGTGTGGAGACGCCCG
AGACGCAATGGCGCGCTCGTTGTATGCGTTTTTGTTCCAGTTTTTGGTCTCAAAGGTGAACTCAGCTTCACCGCAGGTTGGGCAAACCACGAACTCGTCA
AGTAAAACGACAAACAAGGATGCTGCGGCGCCTTGTATCGCAGTTCTTGATATCTTCGGGTTCGAAGAGTTCGAGATCAATCAGTTCGAGCAGTTTTGTA
TCAATTACGCGAACGAAAAGCTGCAGTACCAGTTTATCCAGGATATTCTCttgacggagcagcaggcacACATCGAGGAGGGCATCAAGTGGAATGCTGT
CGACTACGAAGACAATTCCATGTGTCTGGAAATGGTCGAGCAACGCCCCAGCGGCATTTTCTCGCTCTTGGATGAGGAATGCGTGGTTCCAAAGGGAAGC
GATGCAGGTTTTGCTCGGAAACTGTATCAACGGCTGCAAGAGcacagcaacttcagcgCATCTCGCACTGAACAAGCGGACTTTGCGTTTCAGGTCCATC
ACTACGCGGGCAATGTGCGGTATTTGGCTGAAGGATTTTGTGAGAAGAACAAAGACCAGCCCAATGCCGAGCTATTTGATGTTTTGGGGAAAACGAGTGA
CTCTCACTTGAGAGAACTGTTCGACTTCTTTAAAGCCAGCGAATCAGCGCAACTACAGCTTGGTCAACCAAAGCTCCGACGCCGATCTTCCGTACTTAGT
GCTGTTGGTATCGGCTCCCAGTTCAAACAGCAACTCGCAAGTTTACTGGATGTTGTGCAGCAGACAGAGACGCACTACATCCGCTGCATCAAGCCGAAC