Description :
From Genome Similarity Track
Location :
Scaffold_27:66236- 67341
Sequence
1105 bases(100 bases per row)
GAAGAGTTGCTGGAATATAGGCAGGGTCGTCGCAACGACGAGAAGTTTCTTAGAGTGTTCCACCTGATGTTGTCGATTAAGCGCAATCGAAAGCAGTGGC
TTCATTCTTACCTCGTCACGAAAATAAGTGTGGATCATGGCTACCGAGCTTTGAACCATCTTCTCCGGTGGTTCAGCAAGCGGCATCGTAAACAAGGTCA
AGCAGACTGTGCTTGACGAAGTGTAGATTGGATACGTAGCGCATTTTTGGGGCAAGTATGGCCACTACGACAAGACCAACATACTGTATGCAGACGAGAC
CAGTGTCTCGTTGGCTGAAGTTGGCAAGTCCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN