Description :
From Genome Similarity Track
Location :
contig_182:6623- 8198
Transcript NameFunction/comments
g11947.t1hypothetical protein

Sequence
1575 bases(100 bases per row)
AAGGTTCTAACTACTGTAAACTATCTGCATACTGAACTCCTGTCTAAACTGACGATCTTCCAAATGGGTGGCCCCCATTTGATCCGCTACGGTAAGTCCG
ACTCCGTACCTAGTGTGATGTACACCATCGTACTTAACGTGCTGCCGAGTGCCACACACCAATTCGTGTGAAGTACGTACTCGTACTTAAGGTGACCAGT
GTGAACCACACCGAAGAACAATGGGTCTCCCCCTTTCACAAGTTCTTTTGCTCGGCAACGGTGTAGGCCAGCGTGGCCCCATTACACCCTCCCACACCCA
AACGGGAAGCACCTGTCCCAGGGGGAATCCAGCGACGAAGAAGGCCCTGCCTCATTCCGCATTTTGCGCCCGAGTGAACACGCACCGAGGACACACCAGG
CCCAACGGGCACGCGACCGAGACGCCCACATCCGGGATGGCGAAGACAGGCGGAGCCAAAGCGCGTAGCGCTGCCGATGCCTAAGAAGAAAGGCGATGCC
GCCCAGGCGCAGAAGCCTCCCAAACACCCGAGAGCAAAATCCGCTTCCAAGAAGCCGGGCGATCCGCCCTCTCGAGCCAAGCCTGCCAAGACCAAGTCCC
GATCCAGCAGCAAGCGCACAGCGGTGCAGCTGCCCGGTCCGCAGGAGGCCAGCAGCAGCAGCGAGTCGGACACCGACTGTACGAACCCTGGGCTCATTCT
TGGCGACGAGGATTGCCCGGATGTCGACATGGAGGAGGCTCCAGGAGCGGACGACCAGCATACGCCGTCGGCATCTACGGCAACGCCTCCAACGACCTCG
GCCAGCGGCAAGGAAACTCCAAGAGCTAGTGGCGGGGCCTCTACGCCTGATGAAACCCAGCCGGGTGCCCCGCGGGACTCGACAAACGAAGGAGAGGCTC
ACACAGCGCACGACGCCCCTGATTCGCAACCTGCGGGCGATGGGCAGGCTGCCGCCGATCGGACTTCGTCCGTCACGGAGATGGAGGTTGATCAAGGCCC
GATTCGGGACGCGAAGCGTTCGCCTCCGGAGGACGTCTCGAACGAGGTCGACTACGACGAGTCGGACTCCGAGAAGGGACTCGAGCAAGGGGAGGTCAAC
GACCCCAATGCTTCCCCAAGCTCACGGAGCAGCAACGCGCTCTCCATCCAGGAGTCCCATGACTCCTCGCAGCAAGGCTGCCGTTGAGCGCAACACGGAG
CGAGCGAAGGCCGAGCCTGCGCGTCAAATCCCATCGACCGAGCGGGAACCGCAAGTCATCACCAACGTCTGTAGTGAAGACGACGTCCCGCTTGAGCTGC
TGCAGCGCGACAACCGACAACATCTCAGCGAGCGCGCTCGAGATGTGAAGGTCGCCATCGAGCAGCGCCGAGACTCGAAGCGCGATCACGAGTCTGCGAC
TCCTCGAACGCGAGAGCAACTTCTCGCATTGCGATACTGGTCCTTCCGAGACTACAGCGAGTATCTCCGGCGGAGTCGGGAACCCGGGCACAGGTTGCCG
CACTACGACGAGTGTCCGGTCGTCTTGTACGACGACACGGGCCTGGCCCGTCAATCCAACGAACTTGAGTTCACG