Description :
From Genome Similarity Track
Location :
Scaffold_12:662250- 668803
Sequence
6553 bases(100 bases per row)
TTGGTACGCTGCTAGCTGGTGGAGCTCCGAATCATATCGATATGAGGCGATTTACGCATATACCCCTCCCTGCCCGTGAGCTTTTCCCAACGCAACCCTG
TAGGGTCGGTGTAGCAAGCACAAACTATCGCACTCGGATCTGGGCGTCCTGCTCGTCAAAGTAACATCTGTAGGCTGAATGGCGCGGCTGTTGAGGGCCT
GGGGAGACTGGTATGGGCCAGCGCAGCGCTGAAAATGCGGCTGGGCCCTCGGCATCGAGCAAGAGGATCATCAAGCAAAATTGACAAAAGGTGCTCCGAG
CAACAATCCACAGACTTCGATGACCGCTGACCGGTCACGACAAACAAGGGAAGGCGTGCGCCGCCGGGGAATCGAACCCCGACCTCGTCCGTGGGAGGGA
CGAATCCTAACCATTAGACCAACGGCGCGCCAGACAATACCTATGTTACCCACAAACAAACCCCACAAGAACACAACCCTAGCCAAAACAAAACGCTCCC
AACGCCAACGCACCGCCCCACTCGATACCGACAACACACCACGCACTGTCCAACACCCTGTGTGGACCGCCCCCAACCCACCAACTTAGCCCTGGGAGCG
CGTGGTTGCGTCTGCAGTTTTCTTGCGTTCAGGCGCAGCTGAACAGGAGAAAACAAGTATCGCCACGAGCCAGAGGTCGAGGGGGCTTGCCCGCACGCCG
TGAGGCACGCGCATCGGCCCAAAAGCGCGCAAAAGACGGGGGATGTGCAAGAACAGCTGGCAAAAGATGCGCCGTCGGGGAATCGAACCCCGACCTCATC
CTTGGAAGGGATGAATCCTAACCATTAGACCAACGGTGCACATTCCACGATCAAACACACAAAAACACACACCAAACGACGCACAAACAACCATGTCAAC
CACGCATACTCTATCAAACACCGCCTGTCCTGCGCGCTCACACCCATCAAAGCAAACAACACAGCAAGGCCGCCAACACGCGCGCCAAACTAACCGGCTA
CACACATACAGACAGACAGACAGACAGACAGACAGACAGACAGACAAACACGCACACGAGATCATAAAACCTCAAACAACTCGATTGATCGCGCGCTTCG
ACAGCCGTCAACCCGAGCTTGTCACCCTCGAACACGCACCCCACCGAGCCATACGCACACCCACTCCAACTTGGAGCGGGAAGGCGCTCAACGCGATGTC
GAGGTCGTCTCTGTAGCCCCTCTGTTGTTGGACTGTTGGTACGCTGCTAGCTGGTGGAGCTCCGAATCATATCGATATGAGGCGATTTACGCATATACCC
CTCCCTGCCCGTGAGCTTTTCCCAACGCAACCCTGTAGGGTCGGTGTAGCAAGCACAAACTATCGCACTCGGATCTGGGCGTCCTGCTCGTCAAAGTAAC
ATCTGTAGGCTGAATGGCGCGGCTGTTGAGGGCCTGGGGAGACTGGTATGGGCCAGCGCAGCGCTGAAAATGCGGCTGGGCCCTCGGCATCGAGCAAGAG
GATCATCAAGCAAAATTGACAAAAGGTGCTCCGAGCAACAATCCACAGACTTCGATGACCGCTGACCGGTCACGACAAACAAGGGAAGGCGTGCGCCGCC
GGGGAATCGAACCCCGACCTCGTCCGTGGGAGGGACGAATCCTAACCATTAGACCAACGGCGCGCCAGACAATACCCATGTTACCCACAAACAAACCCCA
CAAGAACCACAACCCTAGCCAAAACAAAACGCTCCCAACGCCAACGCACCGCCCCACTCGATACCGACAACACACCACGCACTGTCCAACACCCTGTGTG
GACCGCCCCCAACCCACCAACTTAGCCCTGGGAGCGCGTGGTTGCGTCTGCAGTTTTCTTGCGTTCAGGCGCAGCTGAACAGGAGAAAACAAGTATCGCC
ACGAGCCAGAGGTCGAGGGGGCTTGCCCGCACGCCGTGAGGCACGCGCATCGGCCCAAAAGCGCGCAAAAGACGGGGGATGTGCAAGAACAGCTGGCAAA
AGATGCGCCGTCGGGGAATCGAACCCCGACCTCATCCTTGGAAGGGATGAATCCTAACCATTAGACCAACGGTGCACATTCCACGATCAAACACACAAAA
ACACACACCAAACGACGCACAAACAACCATGTCAACCACGCATACTCTATCAAACACCGCCTGTCCTGCGCGCTCACACCCATCAAAGCAAACAACACAG
CAAGGCCGCCAACACGCGCGCCAAACTAACCGGCTACACACATACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGA
CAGACAGACAGACAAACACGCACACGAGATCATAAAACCTCAAACAACTCGATTGATCGCGCGCTTCGACAGCCGTCAACCCGAGCTTGTCACCCTCGAA
CACGCACCCCACCGAGCCATACGCACACCCACTCCAACTTGGAGCGGGAAGGCGCTCAACGCGATGTCGAGGTCGTCTCTGTAGCCCCTCTGTTGTTGGA
CTGTTGGTACGCTGCTAGCTGGTGGAGCTCCGAATCATATCGATATGAGGCGATTTACGCATATACCCCTCCCTGCCCGTGAGCTTTTCCCAACGCAACC
CTGTAGGGTCGGTGTAGCAAGCACAAACTATCGCACTCGGATCTGGGCGTCCTGCTCGTCAAAGTAACATCTGTAGGCTGAATGGCGCGGCTGTTGAGGG
CCTGGGGAGACTGGTATGGGCCAGCGCAGCGCTGAAAATGCGGCTGGGCCCTCGGCATCGAGCAAGAGGATCATCAAGCAAAATTGACAAAAGGTGCTCC
GAGCAACAATCCACAGACTTCGATGACCGCTGACCGGTCACGACAAACAAGGGAAGGCGTGCGCCGCCGGGGAATCGAACCCCGACCTCGTCCGTGGGAG
GGACGAATCCTAACCATTAGACCAACGGCGCGCCAGACAATACCCATGTTACCCACAAACAAACCCCACAAGAACCACAACCCTAGCCAAAACAAAACGC
TCCCCAACGCCAACGCACCGCCCCACTCGATACCGACAACACACCACGCACTGTCCAACACCCTGTGTGGACCGCCCCCAACCCACCAACTTAGCCCTGG
GAGCGTGTGGTTGCGTCTGCAGTTTTCTTGCGTTCAGGCGCAGCTGAACAGGAGAAAACAAGTATCGCCACGAGCCAGAGGTCGAGGGGGCTTGCCCGCA
CGCCGTGAGGCACGCGCATCGGCCCAAAAGCGCGCAAAAGACGGGGGATGTGCAAGAACAGCTGGCAAAAGATGCGCCGTCGGGGAATCGAACCCCGACC
TCATCCTTGGAAGGGATGAATCCTAACCATTAGACCAACGGTGCACATTCCACGATCAAACACACAAAAACACACACCAAACGACGCACAAACAACCATG
TCAACCACGCATACTCTATCAAACACCGCCTGTCCTGCGCGCTCACACCCATCAAAGCAAACAACACAGCAAGGCCGCCAACACGCGCGCCAAACTAACC
GGCTACACACATACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAG
ACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAAACACGCACACGAGATCATAAAACCTCAAACAACTCGATTGATCGCGCGCTTCGACA
GCCGTCAACCCGAGCTTGTCACCCTCGAACACGCACCCCACCGAGCCATACGCACACCCACTCCAACTTGGAGCGGGAAGGCGCTCAACGCGATGTCGAG
GTCGTCTCTGTAGCCCCTCTGTTGTTGGACTGTTGGTACGCTGCTAGCTGGTGGAGCTCCGAATCATATCGATATGAGGCGATTTACGCATATACCCCTC
CCTGCCCGTGAGCTTTTCCCAACGCAACCCTGTAGGGTCGGTGTAGCAAGCACAAACTATCGCACTCGGATCTGGGCGTCCTGCTCGTCAAAGTAACATC
TGTAGGCTGAATGGCGCGGCTGTTGAGGGCCTGGGGAGACTGGTATGGGCCAGCGCAGCGCTGAAAATGCGGCTGGGCCCTCGGCATCGAGCAAGAGGAT
CATCAAGCAAAATTGACAAAAGGTGCTCCGAGCAACAATCCACAGACTTCGATGACCGCTGACCGGTCACGACAAACAAGGGAAGGCGTGCGCCGCCGGG
GAATCGAACCCCGACCTCGTCCGTGGGAGGGACGAATCCTAACCATTAGACCAACGGCGCGCCAGACAATACCCATGTTACCCACAAACAAACCCCACAA
GAACCACAACCCTAGCCAAAACAAAACGCTCCCCAACGCCAACGCACCGCCCCACTCGATACCGACAACACACCACGCACTGTCCAACACCCTGTGTGGA
CCGCCCCCAACCCACCAACTTAGCCCTGGGAGCGCGTGGTTGCGTCTGCAGTTTTCTTGCGTTCAGGCGCAGCTGAACAGGAGAAAACAAGTATCGCCAC
GAGCCAGAGGTCGAGGGGGCTTGCCCGCACGCCGTGAGGCACGCGCATCGGCCCAAAAGCGCGCAAAAGACGGGGGATGTGCAAGAACAGCTGGCAAAAG
ATGCGCCGTCGGGGAATCGAACCCCGACCTCATCCTTGGAAGGGATGAATCCTAACCATTAGACCAACGGTGCACATTCCACGATCAAACACACAAAAAC
ACACACCAAACGACGCACAAACAACCATGTCAACCACGCATACTCTATCAAACACCGCCTGTCCTACCCATCAAAGCAAACAACACAGCAAGGCCGCCAA
CACGCGCGCCAAACTAACCGGCTACACACATACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGACAGA
CAGACAGACAGACAGACAGACAGACAGACAGACAAACACGCACACGAGATCATAAAACCTCAAACAACTCGATTGATCGCGCGCTTCGACAGCCGTCAAC
CCGAGCTTGTCACCCTCGAACACGCACCCCACCGAGCCATACGCACACCCACTCCAACTTGGAGCGGGAAGGCGCTCAACGCGATGTCGAGGTCGTCTCT
GTAGCCCCTCTGTTGTTGGACTGTTGGTACGCTGCTAGCTGGTGGAGCTCCGAATCATATCGATATGAGGCGATTTACGCATATACCCCTCCCTGCCCGT
GAGCTTTTCCCAACGCAACCCTGTAGGGTCGGTGTAGCAAGCACAAACTATCGCACTCGGATCTGGGCGTCCTGCTCGTCAAAGTAACATCTGTAGGCTG
AATGGCGCGGCTGTTGAGGGCCTGGGGAGACTGGTATGGGCCAGCGCAGCGCTGAAAATGCGGCTGGGCCCTCGGCATCGAGCAAGAGGATCATCAAGCA
AAATTGACAAAAGGTGCTCCGAGCAACAATCCACAGACTTCGATGACCGCTGATCGGTCACGACAAACAAGGGAAGGCGTGCGCCGCCGGGGAATCGAAC
CCCGACCTCGTCCGTGGGAGGGACGAATCCTAACCATTAGACCAACGGCGCGCCAGACAATACCCATGTTACCCACAAACAAACCCCACAAGAACCACAA
CCCTAACCAAAACAAAACGCTCCCCAACGCCAACGCACCGCCCCACTCGATACCGACAACACACCACGCACTGTCCAACACCCTGTGTGGACCGCCCCCA
ACCCACCAACTTAGCCCTGGGAGCGCGTGGTTGCGTCTGCAGTTTTCTTGCGTTCAGGCGCAGCTGAACAGGAGAAAACAAGTATCGCCACGAGCCAGAG
GTCGAGGGGGCTTGCCCGCACGCCGTGAGGCACGCGCATCGGCCCAAAAGCGCGCAAAAGACGGGGGATGTGCAAGAACAGCTGGCAAAAGATGCGCCGT
CGGGGAATCGAACCCCGACCTCATCCTTGGAAGGGGTCCTTGGTCCATGACAAATTTCGGTACTATTCGTTATCAACGTAATCGTAATATGACTCACACG
AAGCCGTGACGCTGTTGAGCACAAGACATATCTGGTGCAGGTACGGGTTGGCAATCACCTTTTCAATTGAGTTGAGTACGAGTCGGCTCTCGACCTCAGT
GCTGTTGTTCTTGTTATTATTGTTGGAGCCCAATACTCTTCTCGTTGGACAATAAACTGTACGCAGGATCGGGTCGAGATCTCGAGAACGGTGACTCGAC
AGACATCGCAGTATCCTCCGCGAGCATGCGTCAGTTACGTCCTGGGGGCTCCTCCAGCATCATCACGGCGAGTTGTAGAGCCTCGGCACATTGATCACCA
CTTCTAGCAAATACAACACGCGTGGGTGTGGGAAAGTAGGATAAATCGGCGTGATATTTTGCGCCATGTACAGGCCAACCATGCACCACCCACAAGCGAT
AAATTGATGTCCGTGAAGGCGAACGACTCGAGCAGCAACTCTCGGCACCATAGGATAAACTCTACAATGCACTGTTAACACTGTCGCTTTGCGAATGCAT
ATGCAATGTAGCTGCGTCGGCATTTCTCCATTGTGCACTTGCTACGTATAGAT