Description :
From Genome Similarity Track
Location :
Scaffold_115:66195- 71946
Sequence
5751 bases(100 bases per row)
ACTTGTACGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCAGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCCATGACCAAGTTCAC
GATGAGCCAAGGTATGACGTCTGAAACTCCAGGGCCGACCCTGGAACATGCTGCTTTCCCTCATCTCACTCGTGTCGAGTGGGAAGCCCTTCACCGCCTC
GCGGCGGTGTCTGGTGAGGCTGTAATCGCGTCGCTGCTGAGCTCAGCGACGTCCGACCAATAACGCCAAGCAGCCCAAGAGTTCATGGAACGCGAGCTAG
CCGATGCGAATCGGCGAGCAACAACTCCCGCGCGTTCCTCGAAAAATGATGTCGTGAAGCTAGAGACGTCTACCTACTCCGGTGAAGGAGCGAATCGCCT
CCCGCTGAACCGGTGGTTTCGCGAGGTCGACATCGCGATTGCTTTGAGAATGATCGAAGCGCAAGGGACAAAGGTCAATTTCTTATTGTCCCGGTTGTCC
GGGAAGGCCAAGGAATGGGCCCTCGGTAAACTTGTCGTTGATCACGACGCATTCCCCACTCTAGAGTCTCTCCAGAAAGATCTCAGGCTCGCGTTCGAGC
CACCTCAAGACGAATCCCGCGTGCGTGCCGAGTTCTTCGCCCTTCGTCAAGGCAAAATGACTATGCGCGACTACGTTCAAAAGACTCGCCACCTCGCGTC
ATGCATCGTGACAAATCCGATTGACGCAGCATCGCAGGTCCATGTATTCGTATTCGGCATGCGTGAAGGCATGACACGGTACTGCCTGACCCGAGCGGAA
CCTTCCTCTCTCGAGGAAGCATTCGCCCTCGCGTTACGCGAAGACTACGTTGTGGCGGCGTCTTACGCGCACGCGATGTCAACGGCAGCTCGTGAGTCAG
CCCCCGAGCCCATGGAGATCGACGCGATTGACGCATCGAATAATCATCGTCAGTCGACTCCTCGTGGGCCCAACGGCCGTCCTAATCGCCCGCTCACTTG
CTTCCGCTGCTGGAAGATCGGTCATCGCGCGGCGGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACACCGCTGAAGTCTCACCTGCCGTTCAGTCAAAA
AACGGTCAGGGCCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGCCCCCCGGTGGCTACCCAACCTTCTAGCCCTCCTGTGCTCCACGC
ACACTTTAATGCCACCACCACGTCGGGCGACTCGAGGCTGATCATCGTCAGTCTTCATGTCGCCGGCGCCCGGCGACCACTTCGCGCGCTCCTGGACTCA
GGAGCGTCGAATAACTTCTTTCGCGAATCGTGCTTATCGATGCTTCCAAGAGAGATCGCAGTCCGTAATGGTCGAGGTCAGGTCGTCGTCAAACTTGCTG
ACGGAAAGCCACGCCGCGTTGCGCGGCGCGAAATCACGTTGCCATACACATTCGACGGCTTCCGCAGCAACGACGACTTCCTCGTGATTGAGATGAACTA
CGCGTTCGACTGCATCTTGGGTATCCCGTGGTTGTCACGATATCAACCAGAGATTGACTGGTTGACTCGGTCGGTTAAACACCGCTCTGGCTTCGATGTG
AGTGAGGTGTTCACACACCTTCTGGTTGCCCAGAAGGACTGGCCCCATGTCAGGGTCGTGGACCGGTTGTCCACAATGCAGGTTGAGCAGAGAGCGAGCG
CTGGCCCTCTCTGTTTGTCTTGCACAGCGCTGTTGCGCGAAAACCCCTCGCTGCGAAGCGAGGTTGTTAACACTTTGGCGGTAGAGCAGGGGCTCCCGCA
ATCCGAGCAGGCGGTCGAGCATGAGTTCCCGTCACGCAACACGGCAGTCGAGCATGAGCTCCCGTCACGCAACACGACGGTCGAGCATGGGTTCCCGTCA
CGCAACACGGCGGTCGAGCATGAGTTCCCGTCACGCAACACGACGGTCGAGCATGAGTTCCCGTCACGCAACACGACGGTCGAGCATGGGTTCCCGCAAC
ACACCAAGGCGGTTGAGCATGGGTTCCCGCCAAACACTCTAGCGGTTGAGCAGAGGTTCCCGCAACGCGATTCGGCGGTCGAGCAGTTGGAGCTCCCGTC
ATCCACAGCGGTGGTCGAGCAGTTGACACTCCCACCGGCTACGACGGCGATCGAGCAGGGGCTCTCGCCAGTCGATGGCGCGGTCGAGCATCGAGAGCTC
CCGCGCACTACCGACACGGTTGATGGTGCCCCTCCGTGTCTAGAGGGGGGTGATCCCTCGTATAGCGATAGCGAGTCTTCTGTCTCGAGCAGCGGTTCGA
GACGCCGCAAGAAGAAATCCAAGCGACGCCGCCTTAAGCGACGTGGTCAGCCCACCGCCGATATCGCAGTGAATGAGTCCATACACGTCCTGGAACACGT
GGAAGGAGGCGTCGTTCGCTCACGCACACTTGACATTGAGAGCCCACCTCGCGAAGCTTCTTCCATCACACGCCTTCCGGGTCTTTCCTGGAAGCATTTT
CTGCGCGATCTGAAGTCAGGAGACATCGAGCAGGTCTGCTTGATCACCGAGTCTGCCTCGGCGGAAGAGATCCACACGGTCGCTACCGACAATCTTCCAC
TTCGTCCAAAGAACGCTGAGCCGAAGTCGGCGCGCGAAGAGCGCTTCGCTGCCCAGTCGTGGGAGTCACTCCGCGACTCGGGCAATCCAGTATACGACAC
CGTTCGCGAGTTCGCGGATGTTTTTCCCGACAAGATTCCAGCTGAGCTCCCTGCTGACAGAGGCATTCGCCATGAGATTGATCTCACGCCGGGTTCCAAG
TACTGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAGGTTAAAGCCATTGACGACTTCTTCGAGAGCCGCCGCAAAGCGGGTCACGTGCGCGAGAGTA
CCTCGCCACACTCGAGTCCGACGTTCTGCGTGAAGAAAACCCCGGGTGTTTGGCGCATTGTTCACGCTTTTAACAAGCTAAACGACGCCACCATTCCAGC
ACAAACGCCGATCCCTCGGAAAGATATGGTACTTGACACCATGGGCCGCAGTTTTATTTTCAGCACCATCGACCTGACCGATGGCTTCTATCAGATCTTG
ATGCGACTCAGCGACGTCCCGCTCACAGCGGTGAGCACTCCCAGCGGGATGCTGTGGGAGTGGCTTGTCATGCCGCAGGGCCTGAAAAACGCACCAGCCA
CGTTCAATCGCATGGTTTCCCACGTTCTGCGCCCACTTCGCGACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCACAGCCGCGCTGAGGGCGATCT
CAGCGCCACAGAAGTTCACTTAAATCACTTACGACAAGTGTTCCAAGTCATGCGCGAAAACAAACTGTACGCGAACTTGAAGAAGTGCATCTTCTGTGCC
CCGGAAATTCCGGTGCTTGGCTGTTATGTGAGCAAAAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATTTGTGCGTGGCCCACGCCGCAGAATC
AGACTGAATTGCGCCAGTGGCTTGGCCTCGCAAATTATCTCCACAAGTACACGAAAAATTACGCTGGTCTGATCCAGCCATTGTCTTCATTGCTGAAGAA
AGACATCACGTGGTCGTGGACTCCCGAACATCAGTCAGCCTTTAATGCAGTGAAGAAAAGCTTGGCGGAGGCCCCAATCCTGGCGCTTCCAGATGATGCA
AAGCCATTCCACGTTGTTTGCGACGCGAGCGACTTCGCCATCGGCTGTGCACTGATGCAATTCGACGACGAAGGTCGCGAACGCGTCGTGAGCTACCAAT
CCAGACAGATGAAGCCCGCTGAGAAGAATTATCCGGTCCACGACAAGGAACTCCTTGCGATGCGCTACGCACTGATCAAATTCAGAGTGTACTTACTCGG
TGAGCAGACATTCGCGATCTACACAGATCACGCGTCGCTGCGAACAGCGACGAAGAGCCCTCATCTCTCTCAGCGCATGGCACGATGGCTGTCATTCTTC
TCCGAGTACAACTTCGTCGTTCACTACAAGCCAGGCAAGAATAACATCCTTGCGGATGCCCTATCTCGGCGCCCCGATTACGATCCACGCCGAAATTTGG
GTCGTCAGTCACTTGAAGACGCGGACGACGACGAATTGGACTGCGCCACATGTGTGGCTGCAGGTGTGAACCTGATGACGGCGGTATCTCCAATACTTCC
CCTGCGGGAAGAGATCTCTGCCGCGTATCGAGATGACTCGATATATGCCGGTATCCTGGAACACCTTCGCACACCAAGTGATGCCACGCTAAAGACACTG
AGCCGCTCCACGCGCGACCAGATTCACAGATACCAACTTGACGGTGATCTACTGATGTACAGTATCGATCGATTCGATGCTCCTCGCGTCGTTGTCCCCA
ACGACCCCGATCTACGCGCAAGAATTATACACGAATTCCATGACGCTCCAGTGGGTGGCCACTTGGGCCGTGAGAAGACTTTCGCAGCGGTATCCCGCGA
CTTCTACTGGCCTCACCTATACAAGTGGGTGCGCAAGTGGGTCCGCTCCTGCGAAACTTGTCAACGCGTTAAGCCGTCACCGTCATCGCAAGCTCCGCTG
CGTTCTCTCCCTCTGGCGACAGAGGCGTGGCGCTCTGTGTCAATGGACTTCATATTCGGTCTTCCACCCGATACTGACGGTCGTACTGGTGTTCTGGTCT
TCGTGGATCGCTTTAGCAAGATGTGCCATCTCGTTCCGGTTCCGGACTCAATCACCGCGGCCGATACCGCGGTGCTCTTCATCGACGCTGTCTTCCGACA
TCACGGCCTTCCTGAATCAATCGTCTCTGACCGCGATCCCCGATTCACATCGGCGTTCTGGACGAAACTCTTCGACCTCCTGGGCACCAAACTCCTCATG
TCGACGGCGGCGCACCCGGAGACTGACGGGCAAACGGAACGCGTCAACCGCGTGCTAGAAGATGTTCTGCGCAGTTATGCCCCGTTTTTCGAGAAGTGGA
GTTCCTTCCTGCCTCTTGCGGAGTTTGCACTCAACAATGCCGAGCACGCGTCGACGGGATTGACTCCGTTTTTCGTCAACAACGCGCGTCATCCACGTGT
CCCCGCACAACTTGCTGTGGGCCAACCCACGGCGACTGATGGCTTCACTCTGGAGGAATGTGATAACCCTGCCCAACCGGTTCCGATACTGGTTCAACCA
CCGGTTTCCGGTGAGACAACGGCTCTGCCGTCTACGAGTTCAGCTACTCCTGCAGTAGACATCAACGCGGTGACGCGTTTACAGTCGAAGAAGATCCTCG
CACCCGCGCAATCCACGTCGTCGCCGTTAGTTGACTGGACACACCGAACGCTGATCGCTCCAGCACAGCCACACTCGACTGTGGCTAACTACGCGCCGAA
ACCCCCAGCACGACCCGCTGACAAGGCAGCGGTATCCGACTTTGTCCTTCATCGCCAATCGGTTACCCGATTCGTCCGTGACGCGCTACAACTCGCGGTT
GACAAGCAGAAGGAAAACGCTGACAAACGTGGCCGCAAGAACACAAGTGCATTCAAGATTGATGAGCGGGTATTACTCTCAACGGATGGAATTCGTACCT
CTGCTATTACGAACCTAGGCGCGAGCAAACTCGCGCCGCGCTACATTGGGCCATTCAAAGTACTACGAGTTATGGGAGATGCCTACACGCTAGACATTCC
TACGTCGCTACGACTACACCCGACGTTCTACGTCGGGCGACTTAAGAAGTA