Description :
From Genome Similarity Track
Location :
Scaffold_5:661866- 663466
Sequence
1600 bases(100 bases per row)
CCGACCCCTTGATGTCCTCCTTCCAGACTCGTGTGGTAATGGCGCAGTACGTCTTGTTGCAGGTCTTCCGGCACCACCAGCTTCGCCAAGCGGTCCCGTT
CGCCGTCGTCTCTTCCTGCGCGTGGACAGTAGAGGAGCAGTCCACCGCCGTCTACGTCGTAGTCGTTCGCGATTTTGCTGCAAGCTCGCGCTGCGCCAGC
ACCCAGGTCCTCCAAGTCGCCTGACAGGTACGCCTTGAGGTTCACGACCCACTTCTCTTCGTTTTGAGCTCTCAGAATCCGATCCGTCCTAATGCGTTGC
ACCACATCTAGTTGCAACACCCCTGCCGAGTTTTTGAGCGTGTCCGCGATCGCGTCGTCGCAGCCATCCGGGCGATAGCCCTTAGTCCTTCGGGAGCAGG
AGCTCCTGGAGCCGGTTGAGGACAACCAAATCGTCGTGGTCTGCCTCCGAGGTAACTACTGTGCCCTCTTGCTGATGCAATGCAGTGTTGGCTAACTTGT
CTGCGCTCTGATTCCAGTCTCGCTTGACGTGCAGGAACTCGTGGGCCGGCCATGTTCTCAGGCGATCTAGAGCCGTCGGCAAAGAGGAGTCAGGCCTGGT
GCCTTGCATTCTATCTCGCGTCGCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGTCTTCCTTAGTCAGCTGGTACTTCGTCCCCAGTCTTTCGGC
CAGAGTTCTAGCTCATCTCATGGAAGTCGATCTCTCGCAGCTCGTACAAGATCGAGGCGTAGATCGCGAGGTCCTCAACGAATCTGCTGTAATAGTTGAG