Description :
From Genome Similarity Track
Location :
Scaffold_244:66179- 67406
Sequence
1227 bases(100 bases per row)
TCGGAGCCGCATTGATTCACGACCCACTGCACAAATCGTTTTTTTTGTAGATGAGTTTGAAATTCCAAATAATGCCAGCATCCATTGGTTGTAGATAGGA
AGTCGTATTCTTGGGCAGAAAGTGGATGTGGACGTTTTCAGCTCAATGTCGGCGTCCATGAGCATTGTCAATCAACAGAAGATTTTTACGACCGTACATC
TTCAAATGCAGGGCTCGAACCCATCCCGTAAACACTTTAGTTGTCATCCATGCTTTTGGATTTGAAAAATAAGTCCTTGGAAGAGCACGAATATCCACCC
CTCGAAAACAGCGTGGTTTAGCCTCTCTGTTGATCACAATTGGCTCCAGTTTTCCGTCCCAGGGAGATTGCAGCACAAACCAATGCTAATGCTGGCCTTG
TCCTTCTTCTCCCAGCGATCGCTAACGTTTGACTGGGTAGCATGCGATAAAACAAAGCGGTTTCGTCCATGTTAAATATCTTATGAGGATTATACTGCTC
GAGGAGCTCCATCAAAATGGTGCGTTGATGACCTAGATCTGATGTATTAATCGAGCCTGCATCGCCATGCAGCTTGTGCAGAGAGGTGTCATGTCGAGCT
TTGAACCGCTGGATCCACGACAGCGTGATGCAATCCTGCCCTGCAAGCTTGTTTGCCTTTGCTTGTGGCACGTCATCCGAGAGGATGCCGCTGGCCTCTT
GACTATGGACAAATGCCGAAGGTCCGGCTCAATAGCTGCGTGGTGAGATCTGCATTTTTTCTTGGTCTGGTCGTTGAGAGAGCCATCGAGGGGCTCATTC
ATTATTCACTCCACAGCTGACAGGCCAACTTTCTTCTTAAGACGCGCAGCGACCCAAGGCTGGAGGTCGGCACGCTTGAGCCTTGGGTTGGCGAGATGGT
GACGCCGAACTTCGTTCTTCTCGTAAATGGTGAGGTGCTCGCGAGATGATCAAATGTGTGCTGAACGCGTGTTGTCAAAGTGAGCCACGTGTAAAACGCT
CTAACGGCCAAACAGGGGGGGGGGGGGCTTATAGCCTTAAACGATTTGACTTCATTTCACTATGCCACTCGTTTGGATATGAAAATAGCGTCCTAATTAC
CAAACTGACCTTATATCTGGTGGCCATATAGCCGGTGTAGTCTGTAGTACTTGATACTTCCTCCGTTCTCTAAAATTAGGAATGACGGTCAAATCGCTGA
GGCAATTTACCATACCAAATTCCTTAT