Description :
From Genome Similarity Track
Location :
Scaffold_1491:6617- 8004
Transcript NameFunction/comments
Phypl_g13545hypothetical protein

Sequence
1387 bases(100 bases per row)
CGCTTGCTGGGCGTTCTTTCGTCTTAACGAGGTCTATCACCTTGCTCTCGTCGCTTTCCTCGCTCGAAGAATCCTCTTCAGACTCGTTGTAGATCTTCGG
GTACCTCTTACGAGGCTGTTTGCGCCAGCCAAATTGAGGAAGTAGTCCATAATATGGACTACTTGCTCACAAATTTTAACATGGCTACTGACATTGTTTC
TTTGGAATCGTACCGGGTACATATATTGTTTTAACTCCACAACAAAACCAGACATGTTCTGCAGCAAGTACTCGGAACGACAACCATTGAGCGGTCCAAA
GGTATTctcggggggggggggggggggggttggTGATGAACTGGACTCCCGGCACGAGCAATCTGGGGTATGCTGGTATGTTTATCAGCGATGGATCAGA
CTCACGCTAATACTATCTCGTTTTGCTACTATGTAGGCAGCCTTGTTATTACCTATGTGGCATTTGCGCCCGGGAGTTCCCGAGGAACGAATATTACTCT
CTGAACTGCTGATCCCTAAGAAGTCAAGATTCGAGAAGTGGCAACCAAGTGGTCCAAAAGACGGGAATGTagcgttgggttttggccgagctgggacaac
tcggtcgccaaggcaaccaCCGTTGAACCTTGCCGTGAAAGGCGATAACCGGCTTCGCTTGGCAGATTACACTCCCCGGACCGAGTGCCAAGGAGGATTT
AGTGACGACACTCTCGGCCGGATCTAATACACAACCGGCCGAGGATCTCAAATGCCACTGAAGCTTAAAGTTAGTAAACCTCCCCTATTTGGTCCTTTAT
CGATTGAATAGTTGAGAGAATAAAGTGCCCTGAAATCTCCAACGCTGTCGACAGCATGATTAGGTTCAGTACCCATATCTTATCCACACTTAGTAGGGAC
CGGTCGTACGCTCGATCTGTATAGAGTCGGATCTAGGATCTCCCACAGAGATCTGTTcacacttgatatttgtatataGATATAGGGCTAGCTATAGTAG
GGCCTACAGAGGCTCTCATAGCCGTAGATTCTCATTCCAATAAATCtgcagcccccccccccctaaGTGATCAAGGGTCAAGTCCGACTTCGGTAAGTGT
AACTAGCTTATGGTAGTGCCTGGACAGGCGTAAACTTAGTTTACGTCAGTTGGCGTCGTCCCCGTCGACAGGTTCCCGTCAGCGATTTTCTTTACGTCTG
TTCAGGTTAAACCTGAGAGCAAGATATAAGTTTTAGAGGTATTCTTGAGAGATTACCGATGCATTAGCGGGGGGGGAGCTGGCAGTACAGTAAACGATCA
ACCAAAGGAGAGTCGTGTGAAGACTACGTACAGTAACCTAAGTATGCCTCCAGCATTTTTCTCCGCTGGCAGCTGCTCACTTGGCGC