Description :
From Genome Similarity Track
Location :
Scaffold_121:66168- 67354
Transcript NameFunction/comments
Hyaar_Emoy2810229reverse transcriptase

Sequence
1186 bases(100 bases per row)
CCTTGTCATGAAGTATGCACTGGCGAAGTTTCGCGTCTATCTCCTTAAAGATAGGCAATTTGTAGTCTATACGGATCATGCGTCATTACGCACGGCCGTA
AACAGCCCATACATCTCGCAAAAGATGACGAGGTGGCTGTCCTTCTTTGCGGGGTACAACTTTTCGTGGATTTCAAACCCGGACGACTTAATGTCGTTGC
GGACGCGTTTGTCGTGCCGACCCGATTTCGAGTCGGCTGCGCAGTCCAACAGTGGGGTTGATACCACTGTTGCAACACTAGTCACGAGTGTTCCGTTGTC
AACATTGCTTGACGACATTAAAAAGGCCTACGCAGAAGTAAATCGCTTCTGAGACTAATGGATCATCTAATGACTCCATCTCGTAAATCTCTCTAAGATT
TACCGGCTTTATATCGATCTTCCGCGGATCGATACACAACACGCAACGGGTTGCTATTATACAGCCGTTACCGGCGACGCACTTCGTGTTGTTGTCCCCA
CTCATAATGATTTACGCTTGCGCATCTTGTATGAGTGCCATGATGCACCACCTAGTGAGCAGACTTATTTCACGGTATGTCGCGACTTTTACTGGACCCG
CCAGTATCAGTTTGTGCGCATTCGTGCTTGTGAAGTGTGCTAACGGGTGAAGCCCAGTCCTTCATCTCGTATGCCACTACAGCCTCTACCAATCCCGGCT
GGTTGCTGGTAGTCCGTTTCAATGGACTTCGTCTTCGGGCAAACCGAAGACGCTCACAAGAACAATGGTATTCTTGAGTTCGTAGACCGATTCAGCAATA
TGGTACATCTTGCTGTAGTTAATAAGTCAATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACACGGTATTCCGACTCCATGGTCTACCCCGTGAACT
AGTCTCTGATAGAGATCCACGGTTCACGGCACGTTTTGGCAATCCGTGTTCCGATCCCTTGGAACACGTCTGACTATATCTACTTCTGACCATCTCGAGA
CTGATGTTCAGACAGAAGGTGTCAACCACGTCCTCGAAGGGATCCTTCGAGGATACGTCGAATCTTTCACAGATTGGAGCGAATTTTTGCCGATGGTGGA
GTTTTCAATCAACAGCTCCGTGCATGCATCGACAACGCATACACCATTTTTCGTGAATGGCTTACGCCATCCACGTCCACCCACTC