Description :
From Genome Similarity Track
Location :
contig_24:661628- 689334
Transcript NameFunction/comments
g5783.t1XP_009529787.1 hypothetical protein PHYSODRAFT_508840 [Phytophthora sojae
g5784.t1hypothetical protein
g5785.t1XP_009529790.1 hypothetical protein PHYSODRAFT_302408 [Phytophthora sojae
g5786.t1hypothetical protein
g5787.t1hypothetical protein
g5788.t1hypothetical protein
g5789.t1ETK87864.1 hypothetical protein L915_07772 [Phytophthora parasitica
g5790.t1hypothetical protein
g5791.t1hypothetical protein
g5792.t1hypothetical protein

Sequence
27706 bases(100 bases per row)
AGCGGCATGGACCTGGACGTCTTCGCGCAGATGCAGAAGGTGGCGATGGACGAGTCCTGTGAAGGACGCAAGCGCGAGCGTCTGATGCGCGTCATCGACA
AGTTCCAGCAAATCATTTCGGCGCCGGAGAAGTGTCGGGTGCCGGTTATCGCGGCGGTGCATGGTCCCTGCATTGGCGCTGGCGTCGACTTCATCACGGC
CTGTGACCTGTGCTACTCAGATGTGAGCGCCATCTTCTCCGTGAAGGAAGTGGATCTGGCAATCATCGCTGATGTGGGCACGTTGCAGCGTCTTCCGAAG
CTCGTAGGTGAGCGCCAGGCTAAAGAACTAGCGTTCACGGGACGCAACTTCGGTGGCCTGGAGGCGGAGAAGCTTGGACTTGTGCTGAAGGCGCTGCCAG
ACCACGAGGCGTTGATGAACCATGTTGGGGACGTGGCTAAATCTATTGCCAAGAAGAGTCCACTCACCATTCGTGGCATCAAGCAAACGATCCACTACCA
ACGGGACCACTCGACGGCGGACTCGCTGCAACAGATTCGTTACCACAACGCGGCGGTGCTGTACAGTGACGATTTGGTGCAGGCCGTGGGTGCGCTCATG
AATGCGACCGAGCCCACGTTCCGGAGTGACTAGCGAGTAAAGTCAAGAAGTTGTTTTCAATTCCCTCAAGAAGAGCATGGGCACACAGCAACTGCTGCCG
CCATTCATGTTCCCTTTTTTTGATTTTTCTTGTTTCTTTTACGCTTCCCACCTCGCCACTAGCTACATGCGGATTGCCGCCACCACGCCGCCATTATCTG
CGTTCTTCTATCGGTCTGGCCTGGCCTACCGCCTGAATACGCATGGCTCTCTCTCTCTCTCTCTCTCTCTCGCTACTCCTTCTTTCGAGCGGCGATAGCA
GACAAAAAGTCTCCTCGCCCAGGCATTCCTCCTCCTCGGCCGCGGCCACGAATAGCAGACAGCAAGTCACCTCCACCACCGCCATCACCGCCGCCACCTC
CGCGTGCCTTAATCGAAGAAAATAGGTCACCGCGTCCAGGTCCACCCGGCTTACCGCGACCGCGACCACGAATTGATGAAAGGAAGTCGGTGGGGGGTCC
CGGAGGACCACCCTCGTCACCACCACGACCCTTAATCGCTGAAAACAGGTCGTTACGGCCACCAGCGCGACCACCACGACCCCTACCGCGTGCAGCCATC
ATTGGGTGCGGTGCCCGGGCTGGGCCAGCTTCTTCGGCCGCCTCACTTTCAGCTGGTGCTGAAGCACTTTTGTTCTTATCCTTTGCTTCCTTCAGGATTT
CCGATCGCGTCTTCACGCGGCGGGTCATCGGCGGACCCTTATCCTTCAGCGAGTTCAGCGTGCTACGACTTTTTTCACCCAGGTCCTTCAGAAGGCCCCG
AATGACGGGAATTGCCGAGCGCAACCGCTTGTCACTTGCCTTCACCTCGTCCATACGCTCGTCCATGCCGTCAAAACAGTCACACACCGCATCACAATAG
AGCAGGATCAGGTTGCATTCGATCGACGAACGCGCATCCTTCGCATCCAAAGCTGCATTGCGCTTGCCAGACAGATTCATGCCCGACCGCTCGGCAAACT
TCAAGCTTACCAAACGAACCTCGTTCACCAACTCTCCAAACTCTGCCAGTTCAACCTTAATTGTTGCAGCAGTCTCCGTATGCTCAAGCCGGCGTTTAAG
CCTTGCCTGGAACCAGAGTAGCTGCCGATTTTCGATCTGATCGAGCGATGTGTCAATCAATTCACACGCGCCATTTGCTTCAGCGACCAAACGCACGTTC
TTGTAGTGCTTCTTCAATGCGTCGGCACGGGAGTTAGCAAGTTTAGCTCGGGCCAATTCCTGCGCTTCTGCCAAAGCTCGCGCACCAGCATCATCGGGAT
TGCCTTTTTGAACCGTTGATTCCATGTACTCGTCACCATCGGGATAGCCAAGATCCTGGTCGTACGCCGGGGATCTGTTAGCTTTAATGGGACACTGCTT
ACCAATCATGGGGCAGCCGATATCCGGGTCGTCGCGCGTAGCATACGGGTGATTATCATCAGGTCCGTACTGTTTTACGTGCTTGTTGTACGAGTTTACA
ACAGTCTTGAACGTCTCCTTGAGAGCCTTGAACCACTCATACTTCTTCTTCGTCATTTCTTCACCCTGCTGCGTCTTCCACGTATCCGCAATATCACGCA
AGTGCATGTGCAGGGCACGGCGCTCTGTCACCGTAAGACCCGTAACACGGAGATTCTCCAGCAACGAAGGATGGTTCTTCGCAATATCAGCTGGGTTCAC
ACGAATCAATTCCAGCACATTCGTTCGCTTGTACTTACGAGCAATATCACGTGGGAGGGTCTTGCCTGTTGGTGACTTCACGGTCTGAAGGTCAGCCTCC
GACATCTTCTTAACGTCGACCGGCATCATCCTACGAATTGCCTTCAAAGCCTTCACGTTAGCGTCGTAGTTCTCCTCTTCCCATTCGCGCTCCTTTCGCG
CTTCTTCGGCTGCGTACTCATCAGTCAGCATCAGTGCAGTGTTGTACTTCTCCATATCTTGCTCAAGGCGGTAGTATTCTTCGCGAAGCTGCTTCTGAAT
TGTAGGATCTGGGTGGGTCACATCGGCAGATCCGATTTCTTGCATGCGCTTCGAGATCTCCTGCACCTTCGCCATAGCTTCTTCGTACGGGATATCTGCT
GCCACAGCAATACCAGCTTGTTGCAACTGCTTCTCGAGTTTCAGCAGACGACGAAGCAGTTTCACTTGGTCACTCGAGATATCCAAATTGGCCAACATAT
CCTGCGCCTTGGGCTCTTCTCTCTGTCGCGTGGAGCGACTTCGCTTAAGCTTTTCTACTTCTGCCTGCAAGGCACGAATCTTCTCGTCGTAAGAGTTGAT
ACCGTCAAAGAAGGCTTGGATTCCTGTTTCATCGACACCGTCCTCTTGCATTTTCTTTTTGACGTCATCGTTGGAATGTCCATCCTGAATCATGCGTCGG
TAGGCACTGTAGATCGACGGACCCTGTACGTCTGATTCTTGAATGCGGCGGTTGGCCTCAATCAAATTTTGTGCCTCTTCCTGCGCTCGTCGGGCTTCTG
CCAGTTGCATTTCTGCTTCCTCCTTAGCTCGGGCAGCTTCTGCCATAGCCTTCTCCACAGCTGCCTTGCCTTCGCGTTGCTCTTCACGTGCTGCAGCCAT
AGCGGCTTCTGCTTTCTGTCGAGACTGCTCCAGAAGCATGTGTGCTTCCTCCTGTGCACGAGCAGCATGGTGTGTAGCTTCATCAGCAGCCATCTGAGCC
TCGGCCTTAATCTTGACCATTTCATCACGCTCGTTCATCATACCGTTGCTGTTCAAGTCATCACCAAGACGGCCACGTTCCTGATCCTCCTCGTACGCCT
TCTGCTTGTTCACATATTCTAGCGACAACGTCAGCACCGCTCCTGCAGACCGGCTACCAAGTGCCAGGGGGTACTTCTTAGTCGTCTTTTGCATGTTCGG
TAGCGACTTCAAGGGAATTGTAAGCGTCGCAATAAGCTCCGTCGCGCGGAACAAATGCTCGTCAAAGATACGAATCTCCACCACCATGTCATCCCTCGGC
GCTTCGAATGAAGCTGAGTTATCCTGCTTCCATACAGGTGAGCGCTGGTTTTTCACCACAGAAGTTTTGAAGGTCTCTGCGCCAACTGTGACTTCACAGA
TTGCGTTCACCGAGCTACCAGATTTCGTCAAGTTCGTCGCAGACAAAACACCAACGTGCACCACAGGGGTTGAAAACGCTTCGTAGTTGAACTGCGAAAG
ACGACCACCAGCGTTGCGGTCCAAGAATGTTCCATCCATAGAAATGCTCTCGGTACGCTGGGTACGCAAAGCCTTGGCCTCCCTCAAGGACTCCCCAAGG
TTCTGTGTACGGTTGACAGTCTTTGAAGCATCGACAGCAAGCTTGACTGCATCCATCCAACCCTTTTTATCCGATTCAGAGGTGCATGCCATCACCATAC
GACGGTCGTCAACACGAAGCTCCAACAAAAATTCTGCTGTCACGTTAGGAGACCGGCAAACGATATCTCCCGTGCCAGGCAGTGAGCGAACAGTGCAACG
ATGATTCAGAAAGCTCATCTCGCCGCGCGAAGTCGTAGAGCTTGGGCTCTTGAAATACTCCACCTTCGACACACTCAGCACGAAGTATCGCGACTTCCAA
TTGCGCATCACACGTCCCTGCTTGTACATGCGTCCCTTTTTGATGGTTGCCGCTTGGTTATCCAAAATCAGTTGCGCGATCGACTGGTTATCATCACCGT
CATTGCCCTCGTCCTTCACAATGCGAGGATTGTTCATCAGTTTCTGCTTCACGTGAGACGTGGACTCGCGAAGTCGAAACGACTCGGAGTGTCGAGAGTT
CACACGCTGCACATCAGCCAACTTGTCCTTAGGTACAAACTGCAGCGTCTTGGGGGCCGTCGCGTTACGAAGCACGTTCATGACCTCAAGGTACGGCATG
CACAACACATCCGTCTCGTTCACCTTATACACAATATCACCGATCGAGATCATGCCGCTCGTCTTGGCTTGACCCTTTAACGCACGGACAACAGCGCCGT
CAATACCGTAGCGAACTGCTTCCTCCAAGTTCAATCCCATCGGCCCGTTGTCGAACACCACAGCGTACGTCGTGAGCTGGGTATCCAGATCATTGTCCTT
GTTGGCCTGGAACTTGGCCCGCACAGCTTCCTGGCGTCGGCCTTCATCAATCTCAAAGGAAATGGCAAGTGGTCGAGGCATCTTTCGGATCAAGTCAATG
GCGTCGGAGAATCCCATGCCGTCCACATCCTGTCCGCCAATAGCCACGATCAGATCTCCAGCCTGCACCTTGTTCTCCAGCAACGGGTTGTTGATGTTGT
CGATGGCCAGGCCGTGGTTGATCACGCCGTCCTTGGGGGGCATGAGTTTCACGCCGAGTTTCTCCTTGGCAGGCAGCTCGATGACCACGACCTCGGGCAC
CGAGTCATCTCCGCCGTTGTTCCCATCGCTGCCAGAAGGCCCCGCAGCTTCTTGTTGTTGGTCTTCCTCCTCTGGACGCTCCGACCCGCAGGCCACACAT
GCCTCTTGGCCGTCCTCGTTGGCCGTGAACTCGCACGCCGTGCAGGTCCACGCCATCTTGCGTAAAATTCGCGAGCTGACCTCTGTTAGAATATGACAAC
AGAGGGAGGTTAGATATCGCTCGTTAACCCTCTTCCTCGTTATAATAAGCTGGAGGGAGATCTATAAATGGGAGGGGGGCGTACTTATTAAGGCTGGTTC
TTGGCTCTCTTGGCGCGCCAGATGCTGGGGATCGCGAGGCCACTACGAGCCGTTCGCCGCGTCGGAACTGGACGCGTGCGCCGCCTGCTGCTCCTCCGCG
CACTCGCTCACGAGGACTGCGTGTCCTCGAACTGCTTCTCTGGTCTGCGACCACCGCCGCGCGCCGCGTTTTCCCTTTTCGCGATCGACGATGGAAGGAG
ACCATCACTCCCGCTAAAGAGCGGGCTAGGGGTCTTTCAATAGTAAAACAAAGATACTGGTGGCGGCCTGGATCCAAACGGTGAACCCTGCTTTCGTCGT
GAACCAGTCGAGTCAGTGGAGACTTGGCATATACACCGCTATCGGCGTGTCGGCGTGGTTTAGCTACATGTATCGGGCGCTATATAGTGCTGGGCGACAT
TGTCGAGGCGGGCCAAAGCGCCGTAGGTAATGGGCATCTTCCGCTCTCTCTGTTAGGGCTGTCAACGTTTTGCGTAGACTGACAACTGACAGAAAACGTT
TTGTGCAGTTGTCAGTTTAGCCTAAAGTGACACAAACGGACGCTAAACTATTCAGCTATCACCAGCTGTTTCGCACTTACCTGACGATATACCTCTGGAT
GATATACTCAACATTATGCGAATAGACGAGAACACGCCGAATTCTCTCTCTTAAACAAGCTGCGCCATGTCAGCTAGAAGAGCTCGTTGCGCGCATGGGG
CTGTGCATCAATGCCATCTTCATCGTCACTAGCGTGCACGATCGCTTTCATGACCTCCATCTTGAAAATGCTGGGGTCGGGATGGCGGGAGCTTCCCGCC
GGAGGGGAAAGACCTCACAACCGAGCAAGATCAGAAATGTATGAAACAAAGCATTGGATAGTTTAGTGTCAGTCTGTGTCAGTTTTCGCGTGCAAAAACT
AAACTGACAACGTTGTCAGTTTAGTTTCAGTTTGTGTCAGTTTAGCGCTAAACGTTGACAGCCCTACTCTCTGTACGGATCGGGTGGTGGTGTGCCCGCC
ACGCCGCGTTTTTGGTCCGGCCTTTGCGAGCGGCGCTGTCGCAACGATCCAACGACTGGGGAATTGAAGTGGGACGCGAGGCTCGCGTACGAGGCTCGAG
TCGAGCCTCGAGAGCCACTGGTGTGCAGGATAGGCTGCTGCCGATGCCTCGCAGCAATGCCATCCCATCGTCGAGCAGCAACAATTGGGGTCTAGCGAGC
GGTAAAGAGCATTGCAGCTTTTTGCCGTGTTTAGTTTGATGCCGTCAACTGCAGATGACCAAGCTTGGGTGTACGAGGCGTAATTACGACACCATACACA
GGTAGCTGTTGCTCTGAAGGTGTCCATGCAACACTGGAGACCACTGAGGCGTGTCCTATCTTGTTCCGGTGCCAAGCGTATGGTAGATTAGGCCGTTCCG
AGCAGTCGATTTGGCCAACAGCGTGAGAACCGACCTCACAGTCAGGTGCACTGTTAGACTACAACCAAATAGTCACTTGAGGCGATTACTGAGACGAACA
CGAAAGCGAATGAATACTATTTATTGAATAGGCGGAGTACAGCCCCAAAGCAGATCAAGAAAGCAAACACAAGTTGGAGGCCTCTATGGAGGGAAGCCAC
GAGGAAAGGCAGCTAGTTACGTGTAGAAGGACCATTGACGGCAAGAGCGCTGTTGCCGGGGCTTGCCCTTCAACATGCGAACACAACCTATCTTATCGCA
TATATTTACCTACGTTCTAGCATGCGTCGCTTTCCGCACTTAGCGCCGCCCTCCATTGCTTTTGGGCGCGCGACATTAGCTCTGCCCCCTCTCGATCTCG
CCATGGCCTCCAACGACGTGGACTTTCGGGCGCTGTACCAGAGCTCGCTCAAGCTGACGACGTCCGTCGGGGAGCTGGGCATCCCTCGTCTGGAGAAGCG
CCTGGAGCAGCTGGACGACGCGTCGCGCTCGCTCAATGGCAGCCGAAAGCGGCCAGCGGCCGACAAGGCCAACTTCCTGCTGGCGGCCAAGGGCATCGAC
GCCGAAAAGCTCAGCAAGGAGCTGCAGCACTTCGAGATCGCACCCGAGTTCGAGCCCGAGACGCCGCTGGGTGAGACGGACCTGGAGGGGTATCTGGCCC
ACCACCACGAGATGATCGTGCTCACGGCCATCGAGGACGTCAACCGCCGCACGGTGGAGGCCACCCACGACCGCATGAACCGCGCCATGATCGACGACTT
CGAGGATGCCAAGCAGCAGCTGCTGGAGGACCTGGGAGGTGCCAAACAGCTCGGCATCCGCAACTACCCGCGGTTGCTAGAGCAGGACGAAGCAGCGGGC
AGCATCTTCGCTTCTGCAGCTCGCGAGAAGCGCCAGGCGCTCGAGCCGGCGTCAGGACTCGGACTTAGTGGCGCGTCGTTTGCTGGCCAGCCCCGCTTCC
AGTCCACGACGAGCTCGGCGCAGATGTCACAGCTGCAGGTGGAGAACGCCATGAGCGAGGAGATGAAGCAGTACTACTCGGTGGTCAGGGAGCTCAACAG
CAGCCGCGTGCCCAACACGCGCAGTCAGTTTGAACTGGCGCGTTATTTCCAGCGGCTGTGCGCGTCAAACGTGTCGATCTCGGTGACGGGCTCCAAATGG
GAGGCTGTGCTCAAGTGCTGGCAGCTCGTGAACGACATGCTGGTGGGTGGAGATGCCACGAAGCCGAACGCGGCGAAGCTGGCTCAGCGCGAGTTTGCAG
GTGTGAGAAACGGAAGCGATGAAACACAGCGGAAGCTGCTCCAGCACCGCTTTGCTTTTGGCGCCCGTGTGTTCCTTGAGAACCAATTCCGTGCGTTCAT
GCAGGAAACCGTGCAGAAAAACAACCTTGCTACCGGCGGAATTCCGGACCTAGTGTCCACAGTGCGTGCTTTTGTGAAGCACCTGCACAGCTCGCGCTAT
GCTGCCAACGGAAGCGGCAGCAATACTGATGTGGACAATATTTGGACCATTGTGTACTACTGCCTCCGCTGCGGTGGCGACCAGGAGGCTGTCGATCTCG
TGACTAGCCTGGCAAACGCCAGTGACTCGGATTCCCCGATTGACGCCGACGTGCTTTGTGCGTTACGATACCGTGCACACCAGAAGAGTCTGTATGAGGA
TCGCAACGCCAACCCGTTGAACGCGTTCTCGAAGCAGTTCCCTGCTGAATTCGACCATTTGGTCGACCGCTACCACCGCTTGATGAGTTCTTCGATTGAC
GCAGTCCCTGTTATAAACCCGTTCGAGCGCTGCGTTGTTAACCTGCTGTGCTTTGGCAACGTCAACGCGAATGAGGCGCGTATCATGACAACTGTAGAGG
ACTACCTGTGGCAGCGCCTCTGCTTCATCCAGCGCGTGGCAACTACTAGCTCTTCTTCGGACAGCACTTACACGATTGCCACATTGTCCAGGAGCATCCA
GAAGTTTGGCCCCACGCACTTTGAAGGCGGGGTGCAGCCTGGAGGTGGTAACTTCTCCGCGTTCCTGTACTTCGAAATCTTGCTTATCACGCAAGAGTAC
GAGAAGGCAATTAAATATCTGGCGTCTAAGGGCTTTCTACTGGAAGCAGTGCACTTTGCGATCACACTGAACCACTATGGACTGTTGGAGTGCACATCAT
TCTCAATGGGAGAAGAAGACCAAACGACTGTCGATTTGGTGCGCCTCATTCGCCAATACATCCATGGCTTCCAGCGAGCCAACGCCGCTGAGGCAGCAGA
CTACGTGGCGTGCATCTCGGAGCTGACTGCGAAGAAGGAGTTACTTGCGGAGCTGCTGCTCGACACGCGCAAGTTCGATGTGCTGGCTGGATTCACAAAC
AGCACAGACGGCTCGCGCACTCGTGGCTTGTACGACCACCTTCTGAAGGATGAGCCTGAAGATGAGGTCAAGGAGCTGATTCTCTCGGCTGCGCGTAAGG
CTGAGGCTCGTGGCCGCCCGCACGATGCGTTCGCTCTGTTGAAGAGCGCCGGCGACATCGAAGGTGTCATCGCTCTGCTCAACTCGCAGCTCAGTTCGAC
TCTTTCGGCCCCACGACCAGAGCGTGAGGAGTGGTTCCGTGAGGCAAAGGAGTTTGCCGAGAAATGGATGCGTTTCCCGTGGGTCCAGGCTATCGCTAAC
CGGCTTGCGCGCACGGCTGCCATTGCATTCCAGACACTTTTGAACATCAGCATTTTCCTTGAGATGTTCGAGAAGCAGCAGTACGAGGACGCTATCACGT
TTGTTGCTGAGCTGGAGGTTGTGCCTACACAGAACTCAAGCAATCTGGCGCTCTGTGTGGATCGCTTCCTTGCCTTCGACGAGAGTGTCCGACAGAACTT
CCACATATTGCTGCTCGGGTATATGGAGTGTCTCGTTCGCGATGCTGACCGCCTGAAGTCCCAGGTTTCAGGTGAGATACGGCGTGCTGGTGTCGGTGCT
TTGCGTGAGAAGGCCGAGCTCCTCGTCACATTCGCAGGCATGATCAAGTTCCGGCTCCCGTCGGGCACCAACGAGCGGCTGAACCGCATGGAGGCCATGA
TCTATTAGAATATGTGACCGCGCACAGGAAAATCATTTACGACCGTCGATGAGATGTACGAGAAGCAAACAACGAACACACATAGTTCGAAACGAAGGGT
TTTCCGGGCTACAACTACACTGTCAGTCTCTCTTTTCGCTGGTCTACTTGCTACTTCTTACGGCCAAAATAAATCTTGCATGCTTTGGCTTCATGCTTCG
TCACGTCTTACAATGCTCTGCTGCCGGCAGCCAAGTATCATGGTTAAATTACCGCAGCGGCGCCTGGCGCTGGGAGAATAGCCGTGAGGCGTTCGACGAG
AACTGGAACTTGCTCGGCGATGTCCGAGATAAGAACCTGGTCGACGCACTGGGCTGCATCAGGTGGTCACCTCGATTGGTGACGAACGCGAACGACTTGC
GGGCGTCGAAAGCCGGAGCTGCCGCTGCGTTCGAGAAGTGGACGGATCGGGCACTGCTGGATTTCCTTCAATGCGGGGCTTTCTCAGCACGAGCACCTTC
TCCGCACTGCTCTCTCCTGTTCTTGCACGCTTGATGGCCGCCTTCCGAGGCGTCCGAATGCGCGTAGGTCTCGACAGTTGGTTCACGTTAGCAGTAGAAG
GTGCAGGCAGCGAGCTCGTGAACGCCGTCGTCGCGGACGAAGACGCTGCAGACGAGAAGAAGGTGATGGGTCTGCCTGTTCCCTGCTGTGGTGCTGCCCA
AGTCGAGGCTGCTGACGTCGTGGGGGCCGGCCATGTGAGGTCGCGCTCTGCGCTGGGTGGCTCCTCGCTGGTGCCGAACCCCTGGAAGAAACGCTGGTGG
GTTGACTCGTGCGACGCGCGCTCAATGCGCTGGCCCAAATTGGTGCACCGGATCTTGGCGGGCGTGACCTGCGCCGCGGGCATGTCGAGTGCGCGTTTGG
TGCGGCGTCTGGTGGCGCCTGGTCCGTACGCCACGCGGATGCACGCCCGCACGAGCCGCAACCGCTCCTCGCCGGCGGAGTCCATGGGAGAGAACATGAA
GTCGTCGCTCTGCATGCTGCGGGTGTGGAGGGAGGGGTGAGCGGCAAGCCGAGATAGGGGAAACGTTGAGAGAAGTGACACCAGCCCTACTTGACGTGGT
CTTGGCAAATGGAGAAATGGTGGTGGATGGCCGCGTTTGAATTTCAAACGTTTGAACTTTAATGTGAATGTTTGGGTAGATTATATGAAAGTTGGGCTCT
AACACTTGTTTCTATTTTTACTGAATTTCTATGTTGTTTGTGGTGTGGGGTACACAACGGCAAGTTGAAGTGAGCCAAACGTCTGCGACCCAGCGTTCAT
CTTTCTCGTCCTTGTTCCTCCAGTTGAGATTTCCCTGCCAAATAAATCAAAGAGAGACTTGTCATGGTGAAGGCGGAGGAGGCGATTTCGGAGCTGCTGA
TGAAGTGTGACGAGAAGGGCATTCAGTCTCCGGAGGTTTGTGGTTTTGTTGTCTAGTCCATTGTGTCACTGTCGCTAACCATTCAGTATCCCACCCTGTA
GAACCCGTGGCAAGCGTTGCGCGAGGCGATCGCGGCGCTCCGGAACACCAAGGACCAGGCACTGGGGTGCCTGCAAGTATCGAACGCTCTCGAGCACCTG
GCGAACAAGTTTGGCACGGAGGATGGAGTAGCGCGGGAGGCAGCTGCAATGGCGCCTTCTCCTCGGGTTGTGCGCACGCAGAAGCGGACGCTCATGCAAG
ACATGCCCAAGCGCAACCGCCGCAACATGATTCTTGAGAGTGACAGCAGCGACGAAAGTTCAAGCGGTCAGTCGGAACTCATGAACGCCATGAGCCCCGT
CGCGAGCAGCAAGAAGAAGAAGTACGCGAAGAAGATCCGCCTGCAAGAGCAAGTGGAGGCCAACCCCGCCGCGAGAAACGAGAATCAGCCGCTCGTGGAC
CAACTGGTGCAGTTGGGCGAGTACGAAATGCGCCACGGCAAGACTCAGCGAGGGCTTGCGCGCTGCGCGCTGCTAAGGAAATCCGAGACAGCAGGATGGT
AATTACAACGGGGGCTCAAGCGCGGCAGCTTGATCACGTGGGCCCGTCGGTAGCCACAAAAATCGATCAGCTCCTGAATGAAGGGCTCGTGGCTGCACTG
AGTGAGTACGAAGGTGACGCAGAGGCTATGCCCGTGGCGAAGTAAGTCATCCAAGCATGCATTTTTAAGGATATGAGTTAGGAGACAAAGACAAATGGTG
GACATCAGTGGAATATAAGGCGTTTTACGATGCCCGCGTCCCAGTTGTTGCGACCAACTGTCTTTGCCCAGCAGAATCCAAGAGAGACCGACGATGAATC
TTCGCCAAGCACAGCGCTCGCTCGCCGAGCTGATCTCCAAGTGCGAAGCCGCGCATATTCAGCTACCGAAGGTTGCTTTGTATGACCTACCTGAACCGTT
AGTTCTATAGTTCTATAGTAACGTCATTCGTTGCTAATCACAGGATTCCTTGGAAGCGCGCTCTGAAGCTGTGGAAAGCATTATTCACTCGTTAAAGGAC
GGAAAGGTAATGAGTGAACTTCTTACAGGGACTCTGTCGCCACTTGTCAACCATTTCTTCCATGTACAGCCAGACTTGAAGGCTGCACAAGAAGAACTTC
AGCAGAAATATGGCATCGAGCTGGTGTGGAAGCAGCACATGGAAAATGAAGAAGCCAAGCGCCAACGTCGTCGCCAATCCCGCCAGAAAAAATGTGGCGG
AGGAAAGACAGCCCCGAGTCCTTCGCAAGGGTCCATGAACCTCGGACTCCTCCCAGAAATGCCCGCACGGTTGGAAGTGAAAGCTCCCACCGTGCTAAAT
CTCGCAGGTGGAGAGCCTTTACAGGGTACAATGAAAAACGTCCCCATAGGTGGTGTGGTGACTCTGTCCAAGCGCCCGGCTGCTAGCCAAGAAACACCAC
ACGTTGGGATGAAAATCGCCAAAAAGGCGAAAAGCACACAGGGGTTGATTGTATCGACAGCTCCGAGCGATACGGAGGAAAAACCACCCCCGAGATCTGC
AGCAGCACTAGGAAATATTCTCAGTGAGGATAACGATGACAATAACGAGAGCGCATCGTCTGGAAATCCTGACCATGATATTGTTGACCTACTGGACCTG
GAAGATTTGAACGAAGTTGAGAGAGGCGGTGGCATGAGCAGCGATGAAGAGTTTGCTCTGTAAACTTTGTGACGGGTGCTCAGTCCATCAATTCGGGCTA
ATCGGAAATGGCACCGTCTTCTACTTCACCGGATTCCACCGACGAGGAAGATTGGGCGAGGACTTGCCGGCGAAAGTTTGAGTGAGCTTTCATCTACGTA
CATGCACAAGGGAAAAGGTGCAAAGTGAGTTTTCGACAGCGTAAGAGCAACATTGAGATAATCCACATAACACCTTGACAAGTACTCACCAGTGTTGGAA
GCTCTCCGGATTCTACCGAGTTGAGTAAGCTGCCATTGCCACCCATCATACTTGAATTTGTGTCCTTCTGGTTACAATATTTCCTCTTGCATTCGCCAAA
AATCTCGCCATCACTGAGGTCCAACGCTTCTTCACGCGAAAGCTCTCCCTCTGACAGCTCAGCACTGCAGATAGAATCTGGTACACTGCTACCAGAAACC
GATAAGCGTCTTCGTTGCCGTTGCGGACGTCGACGCCGAAAGGATCTAGCGCGAAGCTGGTGACGATCAATTTCTCGGTGTATGCTGGACTTGTGCTGAT
AGTCTGAGGTCGAGCTGAAGAGACTACTGATCACTGAAACACTTCTCGAAACAATCTCCAAACTATTTTCACTACTCGCGATGTCGTTCACGTTCAGCAC
CTTTTCCGTGAGAGGCACTGGCTCTGTTGTTGGCAAAGGCAGTAGAATATCTCTATCTCGTTTCCCAGCTTCGTGCTCGGGTTTGTGACCTTGCTCCCAG
TTTTCACTCTCGGATATAGTACTTTTGCATTCGTCTTCCGAAGAAAGCAGATTTTCACTGCCTAGCAAATCAATGCTCGTATTGCTTTGCTCGCGATGGA
TTGAAGGCCTTGGCTCTTGACTAGGTTTCATCGCTTCGTCACTAAATGGCTTCATGTATTGCTCGGCAAGTTTGCTTTGGTGAATACGCCTTTCCTGACG
AAGACGCTGCAAAACCTCAATTGAAGTTACGGTACCGAATAATTCGTGTGAATCGTTACTGTCTCGCAGTGAAGGCCCAAGAGCCCTAATGAAATGTGTT
CGAGAGAAACGCATTGGCTGGGAACTCGTAAGATCTGCTGGAGGAGAGACTGCTGCATCTTCATGTTTTTCCTCAGGAATAACAGCAACTTCAGGTTGAA
GGGCGAGTATGGACTCTTCCTCCACGCCAGAACTTGTGCCCCCGATTCAGTTGCGACAGCTGAGATGTCGGTTGTATCCGTAGCTTCGCCTACCCATTTC
ATGGTTTGATCTTTTGGTTCTTCTGTGAGGTTCTCGATACTCATTGCCCCTGCAGTTTCCAGAGGTGCTTGATAAAGGTTCATCTGTCTGTCTTTCCAAA
TCTGCTGCACTAAGCCACTCACTTGCTCTTCTGTAAGTATGTTCGCCCAGTTCACTAAATCATCGGAGATCGCGTCTTCAGCGGCAGAGTTGGTTTCGAG
ATCACCATACTGCGTTTGGCCATTGTAGTACGCGGCAGCTTTTCTTAAACCTGTGACGTCCTCCTTATCTTCCTGGTTGAAGGTTCCAATGTTGCGAATT
CTCTCTCTAAGCAACTCTTGGGTAATTTTGCAGACCAGCTGCTCGTCGACTGCTTCTTTTCCAGCAAGTGATTCCAAGCTTCTCCGCACTACGGAAACAG
CAGCTTTTCTGGCCTCCACGTTGACTGAATGCGGAATGTCTGTAAGTATCCTGTTGACTAAGAATTCAGGTACTTCCTTCATCACTCTTTCCTCAAACGC
TGCAATTCTCTCTTCAGGACGAACATCATCAACTTCGTAAACTCGGACTTCTTGATCTATCATCGGTGGTTGGGGCTCGCGTGCATGTCGCTTCACCATC
GAGGAGCTGTTTGGTTGTGAAAATATCGGCAAAAGTGTCGACGGCGCGGACAACACCGGGATCCTGGAGTGACTCTCCTTCTTCACTTTCGTTTGGACGG
CAGTTCTACTTCGTTGCGCTTTTTGCTGCTGTTGTTGGTCATAGGCAGCGGTAACAAAGGCTACGAACTCCTTGTAGTTTATCACCTCTTTCATTGGCAA
ATGTTGGTTGGTACGGCTACGGACAGCATTTCCATCCGATGAAGAGTGGATGTGGCGAAAGAAAGATATAATCTTGGTGGTCGGGACAGAAATCTGCAAA
CGATGGAGGGCCATGCACGTCTCGATACGATTCACACATGACCATCTTTATCGGTATCCAAGTCGCCAAAGAGCCGGCGAAAGAACGTCAGCGTTCAAGC
GCATATCTCCAGGATTCCCAAGACCCCCGGCAGAAAGAACTGGGCGGGCACCAAATGACGCAACCGATGGCATAGTACGAAATTCCGACAAAACTTGTCT
GCCAATGGAAGATGACGGACGATCGTCCGTGTGTACTCGACGAGGACTAATTTCTTCGACCATCAACATGTCCCCAGCACCACTATCGTGACGAATACTT
GCGGCTGTCTTCGTTTCTCTCTGATGCACGCTTTTCACTGGAGAGCTACAATTTTGCCGAGAATCTTTCGGTTTTGCTTCGTCAAGCGGACTCAGTACTG
CGTTCCCAGCCGGCTTAGCAAGACCCACCGGGCTTACAGTCTTGTCACCTCCTTTCACATCTTCATCCAAGTCCAGATCATCGTGCGGCTCGTTAGGCAA
TAGCTTGGTCGAATTGGCACTACCCCTAAAAGGCGAATCTGTATCACCAACAGCCCCAAACGCTGCTCTGGGCGCTACATTCTGCTTTGCGTTCTCTTTA
TCCTCACCAGCAACAGGACGGGGGCTCGTTCCTACGTGCTTCATCACCTTCCTCTCCTCAGCAATCTCCGGTTTCCCCCACAATCGTTTCTCGCTCTGAT
TTACTCTAGTAACTCCATTTCTCGTCAATCGCTCCAGTGGTGGCTGCACCCCAATTTCCCCCCCACAGCAGTTCCGACCATTCCTATTTGGCCCCCTCCC
AACACCCCCGCTCTATCCTTTCGCTGCCGATACGGGAGCGCCGTCTCCTTCCTCTTCTGGTTCCAGAACCTCTGCGCTGGAGGATATTGCTGCAGCTCTC
GGTCCACGCGCGCGATGCGTCTCGCCACCTCCCACTCCACGCGGCGTTTGTATCGTCGACTGACCTGCAGACTCGCGTTCCCTTCCAGAGCCACGAGCAT
TTGATCCGCCTCGCCCGTGGCCGACTGTTCGGCCTGCGAGTGCAATCCGCCACCGCGCCGTCTCCGGGGCGCGGCGCTCTTCATCACCAACGCATTGTCC
GTCCAGAGCATCGGCAAACTACTGCGGAGACGCATCTGCAGCGCGCGGTTCCGGGCGCTCACGTCGCTCAACAGCGCGTAGCTGACGTCGAGCGACCGAT
CCATGACTTGGCAGATGGCTGCGAAAGTTGAAGTGTCAACCGGTAGAGAACCGGTAATGTACCATAAAATAGGCACATTTGACGCGACCGTCGTCACCGA
AAACGTCCTGCATTTCTCTGCGTTCTCGATCCCCAATCAACCATGCGATGCAGTGCATGTTTATCGCTGCAAACAAATTGCCCGCAACACACACGTGTCT
GCAGACACCTCTTGTGAACTGGTGGCGCAGCGCCTTGCAGATTCCATTGCGACTTCGTAGTCGCTGATTGGCTGACATGTCTGTGTGGCACACATAGACT
GTCCCATCTGCTCATCCCTGTTTGGCAGCCAGCGTTACCGGGGGCTTTCGCGCCGTCAGTTGCGAACGTCGCTCGCTACAGCATCTCGGTCGCCATGTTG
AGGACAGCACGCTGCCGCCTGCCGGTACGAGCGGCGTCCACTGTCCGCCACAGCAGCAGTACTAGCACTAGCAGCATCCGCCTCCCCCGCCTCTCGGACC
TCGTGCTCATACGGCACGGAGAGAGCGAAGGCAACGTGGCCAGGCAGCGCTCGCTGGCCGGAGACCACAGCCTCTTCGCGGGCGAGTTCAAGCACCGCCA
CAGCTCCAACTGGCGCCTCACGGACCGAGGCCGGCGGCAGGCGGCGGCTGCTGGTGATTGGCTTAAACGCAACAACCTGGCGCACTTCGACCGCTACCTC
GTGTCCGAGTATCTGCGTGCCATGGAGACTGCTGGCCGCATGGGGCTGCCCGACGCGCGCTGGTACGCGGAGATGCTCATCCGCGAGCGCGACTGGGGCG
CTATGGACCTCATGAGTGAGCAGGAGCGCTTCGTCAAGATGCAGGACGAGCTCAAGCGCCGAGAACTCAACCGCTTCTACTACGCACCGCCCGGAGGCGA
GTCGCTGGCCGCGGTGGCCCAACGGGCGGACCGGCTGCTGGGTATATTGAACCACGAGTGTCACGACAAACGAGCGATTGTCGTGGCCCACGGAGAAGTG
ATCTGGGCCATGCGCACGCGGCTGGAGAGGATGTCCCAGGATACGTTCATTGAGTTACAGGAGTCGGGGCGCATGGTGGACCAGATCCACAACGGCCACA
TCTTGCATTACACCAGGAAAGACCCGCAGACAGGAAAAATGGCTCCGTTCTTCACGCACGTGCGGTCCGTGTGTCCGTGGAACGAGAAGCTCAGTCCCAA
GGGATGGATGAAGATCGACCGACCTGTGTACGACAACGAGCTGTTGCTTGCTACTGCTGAGCGTGTCCCACGTATGATCATCTCGGAGGAATATCTCGAG
AAGACGTATAACGGTGCCAAGACGTTATCCGATGCAGATATGAACTCGGACGTATTGGCGCATTCGACGAGTTTGAGCCAGGCGTCCTCGGGCACCGAAG
GAACCACCACGACGGCTGGTACTTCGTCCAAGAAGGAAGAGCGCCAAACGCCGCTTTTGATCCCTGGAAAGCCCATGTTGAACCTGAAGAAGGTGGTCGT
GGTGAAAAAGACGTCTCGCTTCCAGCACGAAGCTGAGTTGTACGGCAACACAGAGTAAGTTGACGTAGCCTGCTTCTGTGTGTCTGTTTACGTTACTGAC
GCTTGCTGCTTCGCATGGTATTTTGATGTTCGGTATTCAGTGAAGCGCTGAGGAAGCAGATGTCGATGCGAGGCTTTGTGCATGACCGTTTGAAGGCGAG
TCACGAGCATCACGTCGAGGCTGTGGACGAAATCACCAGCAGGTACAGCTCTTGTTTTAATCTGCGTGCGCTCCCTGTGCCCTGACGCCTGACTTGGTTT
GGGCAATGATACAGCTTCAAGGAGCGCGACATCGAGGTGAAGGTCGTCTCAGCAAACCAGCTTACGCACGAAGCAGTGGAGGGAACCGACATGATCTTTT
CTGCGGGTGGTGATGGCACATTCTTAAAGACTGCAAGCTTCGTAAACACTCCGACCCCTGTGGCCGGCTTGAATACAGACCCCAAGCGGAGTGAGGGAAA
CCTGTGCTGCTACAAGGTGGATAATGTCACTCACCGATTTAGTACGGCACTGGACCGCCTACTGGAGGGCGACTTCAAGTGGCGACTGCGCCAGCGTATT
CGTGTCGGTATGGTCAACCAGGATGGCTACTGGTATGAGCTGCCTCGGTATGCGCTGAATGAAGTGTTCATCGCGGAAAGTGATGCATCTCGCCCATCTC
ACTACAATATCGGTATCGATCAGCACCAGCGTGAATCCCACCGCAGCAGTGGCATTCTCATGTGCACAGGAACAGGTTCAAGCGCGTGGTACTCGAGCGC
GGTAAGTGAGGATGCCTTTCAATGGGGTTGGCTCCTAACTAACGAGCGTCTGTCTTTCAGTGCCAAGTCTATCGAGAGCAGGTTGCAAACGTCCTTAGCG
CGATGAACCACACGCACACGAATGAGACGGTGACGGAGCTGACAGAATCGTACGTTTTTTCTCTGCTGCAGCTTCAGTGGGGACAACCAAGTGTTGGTGT
GGCTAATAGGTTGTTGTTGTTGTTGTTGTGTTCCCGTGCTCGCAGTATAAACAAGCAGAATGTTTTTCCGGAAGACTCGCGGGACATGGGCTACATCGTG
CGCGAGCCGATTATTAATGCTACATTCGGTGATATCCGGTTTAGACGGTTAGTTCTCGTGCTTGGCAAACTTTCATGTGCAAGCGTGCTTATGTTATTTT
TTGCTGTTTGCAGAGGCAAAGCTCGCCGAGTTTCTATGCGATCCCTTGGGTGGGATATGAAGGTCAACATCGATGGCATCTACTCGGTGCCGCTAGATTA
CGGCGTCCAGGCGGTTATGAAGATCGTTGACGAGCCAAAGTATGTGCTGCGCACCGTGGACTTCTCCCCGCTACCAGGCTCAGCGCCCAAGAAGAACATA
TTTTAGATTCAGCAGATACCAACCAGTTTTGGAAATGTCAATACTCATTCAATTACACGACGCCTTGGCAACCCGAACTTCAATTTGGCAGACATTTTAT
TGTTGTTTGTAGGGGTCAAGCAACTAAACCTACCGGCGAGATCTGGAGCGAGAAGAGTGGCGGCGATGGTGTCGAGAAGACCTCCGAGACGATCGCGAAC
GTGAACGCGATCGTGACGACGATTCTGAACGTCGCCGGCTGCGATGGCTCCTCTCTCGCCCACGCGACGGCGATCGGCTGTCGCTACGACTGCATCTACG
ACGTGAGTGGCGATCATGGTGTGCATGACGTGGCTCTCGTCGTGGACTTGGTGTGTAACCCTTTGACTCTTCCCGCCCTTGTGCCGGTGAATAACGCCTT
GAATGCGAGCGCTCCAGTTCCTTCGCATTGACTTCTTCTCGTGTAGTAGTGCGTGCCATTCGTGCTACGAGCTCCTCAAAGACCTGCTTCTGCTTCTGTG
CAGACAGCAGTGCTGCAGGCTCACCGCCTGACGCTGCGGAGCTGTAAAATGCACGGACTAGTTGCTGAACCTCGTCGCTCTCCCATTGCGTCGTCAGCTT
ATCCGGTGAAGCCAGCTTTTCCTCAAGAAACTTGGTGAGGCGTAGTTGCTCTCCGTCGCGCTTGAGTGCTTCGGACTTGTATTCTGCAACCGCCTTGGCA
TAAATCTTTTCCTGGGCGGACAGTGTCAACAACGCAAGTGCATCGTCTTGAATCTGTTGTATCGCCCAGGTTCAACATTACCTTCCAGCGTCGAAATAAA
CACGCTCACGTAGTGTTGGGCGCCCACGAGTCGAGCTGGAACTGCTCACGCAGCAACTGCGTGAAGAGATGTCTGGCCTGCTTCAATTTGTTTTTCTTCT
CTACCTTGAGATCTCTCGACGGTGCTCGATGAAGTGCTCAAAAATCGCGCGTCGCTCGTCCATCGTCGGCACGCCCATAAAGCGCGGGTCTCCAGCAATC
TGCGGCAGTGCCACGGACCACTTGCAGAACGGCATGATGTTCTTGTCGCGCAGCATGGCACGAAACTGCTCGGTGCGTTTTTGCTCACGATCCTTGCGCT
CCTGCTCCGCCTGCAGCTCCTCTGCTGTCAACGGTTCTTCCTCTTCAACGTCTTCCTGAGTTGGTTTCTCCTCCTTTGCTTTTCCATCTCCTTTTGCTTC
TTTTGCTTTTTGTGCTTCTTCTTCTCTTTCTTGACCATCTTCTCCACCTTTGGCACTTGCTCACTAGCTATTGTTTCCACTATTTGCTCCTTTTCGCGCT
GCGCTGCAGCCTTCTCTGCCTCGACCTGTCCCCATTCACTGGGCCGCTCCCACGCCGACTCGCGTGTCTTCGAGTTGAAGTAATACAGCGTCCCGTTTCC
GGCGTCATGGGCCGTCCACGTGCTAGAGTGAGCAACAGCGTTCTGCACCATGAGCTTCATCATGAAGGCGGTCTCAAGCGGCACGAGGTCCTCGGGCAGC
TCCCACTGGGACACATCCGTCTTGCGGTCGTAGTAGAAGAGCCGTCCGTCGCCGTCGTCGTGCACGGACCAGTCGCCCACCACCTGCAGCGCATTGAGCC
AGTACAGCTTCTGCTCCGCCGTCATTTCGGCGTCGCTGCATGTAGCCGACGGCAGAGGCACCGAGAGTTCCTCGTCACCCATCGCGCCAAAATGCACTTC
GTGTGGTGCACACATCATATATAGTGTGGTGCACCTGTTAAAAATGAGTCAGCTCCAGCCATTGCCGACCAGAATCAGACGTGCAGCTCACTTCGATGGC
GGCTCCGGCTCCGGGGCGCGCGCCAACGGCGAAGCGCCGCTTTCTGACGGACGAGGAGTACGAGGAGAGCAGCTGCTGCTGGACCTGGAAACGGAGCTCC
GGCAGGTGCAGGCGCTCAAGGCGCAGACGCAGGAGCGATTGCAGCAGCTGGCGCTGGACCAGAGGCAGCTGGAGCAGCAGCATCGGCGCCTGCAGCGCCA
AACTGACCGACATGACGCCGGCGCCGCCACCGCGCGCATGCTTCAACTGCAGGAAAAAGAGCGGGAGCGACTCACAGCAGCGGAGGTCCAGCGCGAGCGC
GAGGAAAAGGAAGCGACGGCCAAAGCGGAGGACACGGCGCGACGCCGAGAGAACGCGATCGAAACGCTGGAGGGCGACATGGAGGACCTGGACGCCTTTT
TGGCGCAAGACGCCGCGAATTTCTGAAGTTGCGAGAATATTTATTGCCGACGAAATCAGTGGTGTTTGGAGAAGTTTCTGCGGCTGTTGTTGCCTTTTTC
TCGCTTTGCATGTAGGCTTTGCGGCGGCAGCGGAGACCGCTGAAATCAGTGGTGGTCATGTCATCTGCTTGATAGTGCGATCTCTCGTGCCCCGCTGGTC
GACGAGTACAGTGAGTGAGTACGCTGTACTCTTGTGCAGCAGCATATGGGTCAGCGTCTTCAGCGCCATGGAACCCTTTGGCCATCGGCTCTGCAGCGAC
GAGGGCACCGAGCCGCCATTTGGCCGCGTCTTATTCACTCCGGTTATCGACCACATCTGGTGGCCTCGCCGCTGTCTGAGTCGGGTCGGTGCTGACTGGC
TTCAGTTAAGCGCCTCGGCGATCAGATGGCGGAGAAGATGTCAACCACTTCAACATGGGCCTCGGATCGCGTGCGCTGCTGCTACAGGGTGGTGGCTGGT
AGCGACGGTTCTTTGCCGCTGCTGCTCAAAGTACATGCATGTACCAGGCTGCAGGATGCGCTGTGAACGCCGCTTGGTGGCGAGCTTGTTACCAGCCTCG
GTGTCCGTCAACCGGATGAGGCCAGTTGCGGTGAGGAGTGATCTTCCTCGCTGCACTCGCCTCACCCAGCGCTAGGAAAGGCCCTTGCATCACACAGACA
CAAATGCGCTCTTCCTCTTTCGAATGGTGGCGAGTGCCGTGGCCGCACCAACCTGCATCGGAGTCAGTTCCGAGGGAATCCAAGTGAGACGACACATGAT
TGGCCGAAAATCCGTTCACGCGTCGCTACCACTGGCTAAAAAGAATTGCCTGAGTTCTGAGCGAGGCCAAACAAACCAAATCGAGCCCCCCTCGAAACCC
GCAAACACAACACAAAAAGCCCGAGGAAAGGTGCTCCTCGACACTTGGGAAGAATCGCAAAGCCAACCCGACCCCCCTCCTCAAAAGCCGAGACCATCAC
TCCTGTCCGCACTAACACGCGATGGAGACTGCCCCCACCAAGGACATGAGCGACACGAGCAACCGCAAGCGCAAGATGACGGCCACCACGCCGCCGCCGG
GCCTCAAACGCGGCAGTAAGCTGTCGCGCCCAGCAGCGGCCGTAGGCGCCAGCATCTCGAACGGCGTGACGCCTCCCGTCGTGACCCCTCAGGGCTCTAT
CCACACGTCGGAGCAGTTCATGAACCACCAGCGCGCCATGTTCAGCGCCCCCACGCCGCACGGGCCCGTGTCGCAGATGCCGCCCACGCCCGCCTTCGTG
AACCGCAACGGCTTAGCCACACGCCCGACGGCTTCTCATCCACACCCAGCGACGGCTTCCCGTCCAACTCGGCTCAGCCGACAGCCGCTGGGACCTCCAC
GCCCGCGGACGACAACCAGGCGGGCCCCCACTCGTCGCACGCGGCCACACCGTCGCCTGTACCCCGCGCGGCGCCGCTCAACTTGCGCAACTTTGCCAAC
TGGGAAGTCGGGACCCGCTACACGCTCGTGCGGCTGCTCGGCAAGGGATCTTATGGACAGGTACGGCCACGAGCTCAGTAGAAGAGGCGGTAGAGGAGGT
TCTGAGATCTGTTGTTCTTTTATGTGGTGGTCTATTATGTAGGTCGCTGAAGCGTTCGATACCGAGCGCCAAAGAAGGTGGCTATCAAGAAGATCATCAA
CGTCTTCGACCAGGAGATCGACTGCAAGCGGCTGTACCGTGAGATCTATATCTTGCGTCGCCTGAAGTGAGTAGCGGCTATTGCTAGGTTGTTATCGTGG
CGTTGCTGACTGACTTTTGTTGTTTATTGGTGTGGTAGCCACCCGCAAGTGATCAACCTGATCGATGTGATCCCACCAGAGAACTACGACACGTTTACGG
ACCTGTACTTGGTGTTCGACTTCGTGGACACGGACCTGCACAAACTCATCATGAGCCCGCAGTACTTGACTATTCGCCACATCCAGGTCTTCCTATACCA
GCTTCTGTGCGGGCTGAAGTACGTCCACTCGGCCAACGTGATTCACCGTGATATGAAACCTGCCAACATCCTACTGAACGAAGACTGCACACTTATGGTT
CGTTCCTGCTACATTGCTTCTAAAATGGTTTAGTCGTGTCTAATGTTTTCCTGTTTGTTATGGCACGCTAGATCTGCGACTTTGGACTCTCTCGTGTGAT
GGAGAGCGATATGTCAATGGAGGAGCTGAGCAAGCACCTTTATTCACCCAAGGACTCCAAGTCGCCTACCACATCTGATGGAGGAACCACGTCGGCGCCC
TCTCCCGGAAGCGCGTCCTCGACGCCATCATCCTCTGGAGAATTCCCGAAGATGCGTCGCCAATTGACGAAGCACGTGGTCACGCGGTGGTACCGTGCGC
CGGAACTCATTCTCCTTCAAGATTACGACTTCTCAGTCGACATGTGGAGCGTCGGGTGCATTTTTGCAGAGCTGCTGAGCATGCAGGTCGAAAGCTGCCC
GCGGTACCAGGAGCGCGTGCCTCTCTTCCCTGGGCGCTCGTGCTTCCCGCTTAGCGCAGACCGACCCACTACTTACTCGGACAAATTAGACCAGCTCAAC
GTGATTTTCAACGTGATCGGCACGCCTGGTGAGGATGACATTGGCAGCTTGGGTGAGGTCAAGCAGTATTTGCGAAAACTGCCTAAGAAGGACCCCCGGG
ACCTTCGTGAGGTATATACTGTCTTCTGTACGTGGATCTGAGTGGGAGCTGTACTGACTTGTTTGCTTGTGAACTTATTCAGATGTATCCTGGCGCCCCA
GCCGACTCGCTGGACTTGCTTAAGCACATGCTATCATTTAACCCAGAGTGCCGAATTTCGGTAAGCAAAAGTGTTGCAGTACCGCATCAAATCCTATCTA
ACCACAATCTCTGTATCATCTAGGTCGACAAAGCGTTGGCACACCCGTTCCTAGATTCTGTACGGAGGTCTCAGTCGGAAACTGTAGAAGCTAACCCGTT
TGGCATGGAGTTTGAGAAACGTCCCCCTGAACAAGGAGGCCTTGAAAGGTTCGTGCTTGATATTAATTTGACGGCTAAAGTACATGATGCTGATTTGTGT
CTTTGTTTCATATGCGCAGCTCGTATCTTCGAGGAAATCAAATTGTTTGCGGACCGCAACAACCGGAGATGAATGAAGTCTCTGTGATCTGTTCGACCGC
AACGAGACAAGCGTCACCCAGCTCCGTCATCGACGCGCTCCACGTGAAGATAGATCCGGGCGAAGTGGTAAACGCCGGTGTTCACCATCGGTGAGTGTCG
GTTAGTTTGAGTGTACAGTGTGAGGAAAGGAAAGCAAGAACGAAATGGCGTGTGGAGTACAATGAAGCTACAAGTCAAATGGCGACCGTCTTTATGACAG
CAAGTTCCTCGAAGAGAAGAGGAGTTTTGTGCGAGCCAGCCCGGTAGTGGTTGTAGGGGCACACGTATTCGTTCTTGTGGCACATGCAGTATAAAGGCAA
GAGGCTGACGGAAGAACATACGGAAAGCCGAGAGTAAAAGTAAGTGGTTGCCCGTTTTCGCTTGCCTGGAGACTGCAACGAAGCCGAAGTAGCGGGCGTG
TTGCCTTGATATGCTTGAAGTGTCGTGTGTGTTTTCAATAGATAAAAAGAAAATTGATTTGGTGGAGGCGTTGGTGCCGTTGACATTCGTTACAACTTTA
TTTTTGCTTTCCTAGTCAGCGGAGTGTTGTTTCAAAACGGACATTGAAGTACTCCGGCGATGGGATTGACGACAATCACTTGCTGAACAACAAACCGATG
CTAAACCCTCCACAGACCTGGTCGAAGTTCGCAGTGCTCACCTGACACCGCCAACTGCTTCGGTATTTGATCACCGCGTACGTTTACTTACTTATACATG
ATGGAGACCAGCGTGGATACTCTCGTGTACCAACTGGAAGACGACGACACCAACGTGCGATGGAATACGTTGCAGAAACTTCGGAAGATCGCTGCAGTGG
AGACCTCCCATTTCCCAGTTCGCAACACGCGCCGCTTTCTGCAGTGTATTCGTCGACGGATTGTTGGCGAAGGAGACCCTCACGTCGCTATCGAGGCATT
GAGATTGCTAGCGGACGTGATGCTCTCGCTCGGAGACAGCGTGGACCAAATCCTGTCGTCTATTTTACCCCATTTGATCCCGATCCTACCCCAGAAACGC
AGAAATCGTGAGCAGGATGATGATAGTGAAGACGAATTGGAGACATTGCACGAAGAAATGTTTCAGGTCTTTCGAAAGTACACAAACGTCTCGAACGACC
TGCAAGCAGTTGCCGATCTGCTCGTCAACATCGGTCTCGGGAGCGGTCACGGATCGGTGCGAGAAGCTTCTCTCATTGCGCTGATGCGACTGCTAGATGA
ACGATTCCAGAAGCACGCGGTGACAGCTCGCGGGGAATCTACGAAGGCAGCTATTGGTCGTGGGGACAAGGCGCTTATTGTCGCTCTTGTGCAAGCGATA
ATTCCATCACTAGAGGACTCGAACGAGAAAGTGGTCGTAGCTGCAGAGGAGGCGATCGCCAAGCTCCAGTCGTACTGGGGGAGTCGCTTTTCCACAGATG
TCATGAAGTTTTTGAGCAGTGAGGACAAGCAGACACTTCATGAGCATCGCGAGCCAATTGCAGACTTCGTGCAGGCTTGTACATCATCTGCAACGCCTCC
TTCTTCGCCACCACAGCCGTCAAGGCCGTCTTCAGCAGCATCTTCCAGTGATATGCTCGAGCAACTCGAAAGCGACAAATCATCTACCTCTTCGCGGCTT
TCTCCTTCGAAGGTACACCCGCTGAACATGACAGATCAGCTCCACTTCGGCTTCTTGAACGCAGATATCGTGACGGCGCTAACTACCAACACCACCAATT
CAAATGCAGATTGGAAGAAGCGGGCAGCAGCAGTGGAGAAACTGTACGCAGCCTGCAAGCAAGTCGATGCAGGTGTACTACGCGGACTTAACGCGGAGGA
ACGACTGAGGCGGATGAACGAACTGGAGAATCTGTTTCACATTTTGGTTCGTCTTACACAGGATGTAGACGTTCATCTCGTGAAACGATCACTTCAAATC
ACCCAGATATTGTTCCGCAAGCTGGCCCCCCCACGGCAACTTGATAACGATAGCACGCAGAATGAAAACGACTTCGATATCGGCGAATGCAACGACCACG
AGGCATCCAACAAAGGGCAAAAGGATGCCGCGTATTACATGACACAGATGCTAGTCCCAATGGTGGAGACATCGGCAAATTTTGCCGGAGAAGACGATGA
GATGGAAGGTTTCGTGTACGCTCTACTGAGTCAGGTCTTTGAAAGTGGATGCGTACGTGTGAGCGGAATTGAACAAGTATTAGCTGCGACCTCGCTTCGG
CACTGTCGATCGCGAGTGCGGGAGGAAGCTTTGAAAGTTTGGATGGTACTAATTCTCATCGCCGAGCGTGAACGCCTTCTCTCTGCAAAATACGTGCCTA
GTGAAAATGCGGTGCAGACGTTGGGGCGTCTGCTGGGAGACACCAACGCGCTCGTACGTGATCTGGCTTTTGAAACTGCGGCTGTATTGACAATGGTGTG
CCGCTGTAATATTTATGAGCTACTTGAAGCCTTTATCGAAGACGAGTATGTTGCCGAACGAGTGGATTGGGCAGCATTGCGGGCCAGATTGCGACGAAAG
TGCGTTCCCGAGCTTCGATCAAACGGTACGCTCCGACTAAAACCTGCCAAGGATGCTACTACAAGCAGATCGTATCAAACAGCTTCGACCGTAGAGCAGT
CTCTGGATGGTGTCTCCGAACTGAGAATGATGCTGGCAAATGACGAACCGAAGTCGTTTGAGAATCACCGCCACGATAATCTTTTGATTGAGCCAGTTAG
ACTGGCCAAGGGCAAGGTGATAACTGGAGGAAGTCTTAGCGATCGCTCCTACTTCAAGCAAGAGAAGTCTGCAGAGGAAAGTGGCGCAAGCTGCCGAGCC
ACAATCAGCGATGAGGGAACTACGACGGAAGATATTAACGATAAGCTGGCAGCCTTGAAAAAGAAAATGGATCAGCTTCGACAGCCCCGAGCCAAGCGTG
TACGGCGTCCAAATAGCCAAGAAATCTTGAGTACCGAGCGAAACCTTGAAAACGCGATGGACCCCAACCAACAAACACTGCCACGCTCAAAGAGTTCACC
CGAGCAACCCGCTTACAACCCTGCAGATGATGCTGACACGATGATTCATAGCAAGGATGCAAACTTTTATCCATCCCCAAGAGACAAACGGGTCCACCCG
AGCAGA