Description :
From Genome Similarity Track
Location :
contig_24:661616- 689322
Transcript NameFunction/comments
g5502.t1XP_009529787.1 hypothetical protein PHYSODRAFT_508840 [Phytophthora sojae
g5503.t1hypothetical protein
g5504.t1XP_009529790.1 hypothetical protein PHYSODRAFT_302408 [Phytophthora sojae
g5505.t1hypothetical protein
g5506.t1hypothetical protein
g5507.t1ETK87864.1 hypothetical protein L915_07772 [Phytophthora parasitica
g5508.t1hypothetical protein
g5509.t1hypothetical protein
g5510.t1hypothetical protein
g5511.t1hypothetical protein

Sequence
27706 bases(100 bases per row)
TGGTCTCCGGGGAAGGCCGCGGCTTCACCAGCGGCATGGACCTGGACGTCTTCGCGCAGATGCAGAAGGTGGCGATGGACGAGTCCTGTGAAGGACGCAA
GCGCGAGCGTCTGATGCGCGTCATCGACAAGTTCCAGCAAATCATTTCGGCGCCGGAGAAGTGTAGGGTGCCGGTTATCGCGGCGGTGCATGGTCCCTGC
ATTGGCGCTGGCGTCGACTTCATCACGGCCTGTGACCTGTGCTACTCAGATGTGAGCGCCATCTTCTCCGTGAAGGAAGTGGATCTGGCAATCATCGCTG
ATGTGGGCACGTTGCAGCGTCTTCCGAAGCTCGTAGGTGAGCGCCAGGCTAAAGAACTAGCGTTCACGGGACGCAACTTCGGTGGCCTGGAGGCGGAGAA
GCTTGGACTTGTGCTGAAGGCGCTGCCAGACCACGAGGCGTTGATGAACCATGTTGGGGACGTGGCTAAATCTATTGCCAAGAAGAGTCCACTCACCATT
CGTGGCATCAAGCAAACGATCCACTACCAACGGGACCACTCGACGGCGGACTCGCTGCAACAGATTCGTTACCACAACGCGGCGGTGCTGTACAGTGACG
ATTTGGTGCAGGCCGTGGGTGCGCTCATGAATGCGACCGAGCCCACGTTCCGGAGTGACTAGCGAGTAAAGTCAAGAAGTTGTTTTCAATTCCCTCAAGA
AGAGCATGGGCACACAGCAACTGCTGCCGCCATTCATGTTCCCTTTTTTTGATTTTTCTTGTTTCTTTTACGCTTCCCACCTCGCCACTAGCTACATGCG
GATTGCCGCCACCACGCCGCCATTATCTGCGTTCTTCTATCGGTCTGGCCTGGCCTACCGCCTGAATACGCATGGCTCTCTCTCTCTCTCTCTCTCTCTC
GCTACTCCTTCTTTCGAGCGGCGATAGCAGACAAAAAGTCTCCTCGCCCAGGCATTCCTCCTCCTCGGCCGCGGCCACGAATAGCAGACAGCAAGTCACC
TCCACCACCGCCATCACCGCCGCCACCTCCGCGTGCCTTAATCGAAGAAAATAGGTCACCGCGTCCAGGTCCACCCGGCTTACCGCGACCGCGACCACGA
ATTGATGAAAGGAAGTCGGTGGGGGGTCCCGGAGGACCACCCTCGTCACCACCACGACCCTTAATCGCTGAAAACAGGTCGTTACGGCCACCAGCGCGAC
CACCACGACCCCTACCGCGTGCAGCCATCATTGGGTGCGGTGCCCGGGCTGGGCCAGCTTCTTCGGCCGCCTCACTTTCAGCTGGTGCTGAAGCACTTTT
GTTCTTATCCTTTGCTTCCTTCAGGATTTCCGATCGCGTCTTCACGCGGCGGGTCATCGGCGGACCCTTATCCTTCAGCGAGTTCAGCGTGCTACGACTT
TTTTCACCCAGGTCCTTCAGAAGGCCCCGAATGACGGGAATTGCCGAGCGCAACCGCTTGTCACTTGCCTTCACCTCGTCCATACGCTCGTCCATGCCGT
CAAAACAGTCACACACCGCATCACAATAAAGCAGGATCAGGTTGCATTCGATCGACGAACGCGCATCCTTCGCATCCAAAGCTGCATTGCGCTTGCCAGA
CAGATTCATGCCCGACCGCTCGGCAAACTTCAAGCTTACCAAACGAACCTCGTTCACCAACTCTCCAAACTCTGCCAGTTCAACCTTAATTGTTGCAGCA
GTCTCCGTATGCTCAAGCCGGCGTTTAAGCCTTGCCTGGAACCAGAGTAGCTGCCGATTTTCGATCTGATCGAGCGATGTGTCAATCAATTCACACGCGC
CATTTGCTTCAGCGACCAAACGCACGTTCTTGTAGTGCTTCTTCAATGCGTCGGCACGGGAGTTAGCAAGTTTAGCTCGGGCCAATTCCTGCGCTTCTGC
CAAAGCTCGCGCACCAGCATCGTCGGGATTGCCTTTTTGAACCGTTGATTCCATGTACTCGTCACCATCGGGATAGCCAAGATCCTGGTCGTACGCCGGG
GATCTGTTAGCTTTAATGGGACACTGCTTACCAATCATGGGGCAGCCGATATCCGGGTCGTCGCGCGTAGCATACGGGTGATTATCATCAGGTCCGTACT
GTTTTACGTGCTTGTTGTACGAGTTTACAACAGTCTTGAACGTCTCCTTGAGAGCCTTGAACCACTCATACTTCTTCTTCGTCATTTCTTCACCCTGCTG
CGTCTTCCACGTATCCGCAATATCACGCAAGTGCATGTGCAGGGCACGGCGCTCTGTCACCGTAAGACCCGTAACACGGAGATTCTCCAGCAACGAAGGA
TGGTTCTTCGCAATATCAGCTGGGTTCACACGAATCAATTCCAGCACATTCGTTCGCTTGTACTTACGAGCAATATCACGTGGGAGGGTCTTGCCTGTTG
GTGACTTCACGGTCTGAAGGTCAGCCTCCGACATCTTCTTAACGTCGACCGGCATCATCCTACGAATTGCCTTCAAAGCCTTCACGTTAGCGTCGTAGTT
CTCCTCTTCCCATTCGCGCTCCTTTCGCGCTTCTTCGGCTGCGTACTCATCAGTCAGCATCAGTGCAGTGTTGTACTTCTCCATATCTTGCTCAAGGCGG
TAGTATTCTTCGCGAAGCTGCTTCTGAATTGTAGGATCTGGGTGGGTCACATCGGCAGATCCGATTTCTTGCATGCGCTTCGAGATCTCCTGCACCTTCG
CCATAGCTTCTTCGTACGGGATATCTGCTGCCACAGCAATACCAGCTTGTTGCAACTGCTTCTCGAGTTTCAGCAGACGACGAAGCAGCTTCACTTGGTC
ACTCGAGATATCCAAATTGGCCAACATATCCTGCGCCTTGGGCTCTTCTCTCTGTCGCGTGGAGCGACTTCGCTTAAGCTTTTCTACTTCTGCCTGCAAG
GCACGAATCTTCTCGTCGTAAGAGTTGATACCGTCAAAGAAGGCTTGGATTCCTGTTTCATCGACACCGTCCTCTTGCATTTTCTTTTTGACGTCATCGT
TGGAGTGTCCATCCTGAATCATGCGTCGGTAGGCACTGTAGATCGACGGACCCTGTACGTCTGATTCTTGAATGCGGCGGTTGGCCTCAATCAAATTTTG
TGCCTCTTCCTGCGCTCGTCGGGCTTCTGCCAGTTGCATTTCTGCTTCCTCCTTAGCTCGGGCAGCTTCTGCCATAGCCTTCTCCACAGCTGCCTTGCCT
TCGCGTTGCTCTTCACGTGCTGCAGCCATAGCGGCTTCTGCTTTCTGTCGAGACTGCTCCAGAAGCATGTGTGCTTCCTCCTGTGCACGAGCAGCGTGGT
GTGTAGCTTCATCAGCAGCCATCTGAGCCTCGGCCTTAATCTTGACCATTTCATCACGCTCGTTCATCATACCGTTGCTGTTCAAGTCATCACCAAGACG
GCCACGTTCCTGATCCTCCTCGTACGCCTTCTGCTTGTTCACATATTCTAGCGACAACGTCAGCACCGCTCCTGCAGACCGGCTACCAAGTGCCAGGGGG
TACTTCTTAGTCGTCTTTTGCATGTTCGGTAGCGACTTCAAGGGAATTGTAAGCGTCGCAATAAGCTCCGTCGCGCGGAACAAATGCTCGTCAAAGATGC
GAATCTCCACCACCATGTCATCCCTCGGCGCTTCGAATGAAGCTGAGTTATCCTGCTTCCATACAGGTGAGCGCTGGTTTTTCACCACAGAAGTTTTGAA
GGTCTCTGCGCCAACTGTGACTTCACAGATTGCGTTCACCGAGCTACCAGATTTCGTCAAGTTCGTCGCAGACAAAACACCAACGTGCACCACAGGGGTT
GAAAACGCTTCGTAGTTGAACTGCGAAAGACGACCACCAGCGTTGCGGTCCAAGAATGTTCCATCCATAGAAATGCTCTCGGTACGCTGGGTACGCAAAG
CCTTGGCCTCCCTCAAGGACTCCCCAAGGTTCTGTGTACGGTTGACAGTCTTTGAAGCATCGACAGCAAGCTTGACTGCATCCATCCAACCCTTTTTATC
CGATTCAGAGGTGCATGCCATCACCATACGACGGTCGTCAACACGAAGCTCCAACAAAAATTCTGCTGTCACGTTAGGAGACCGGCAAACGATATCTCCC
GTGCCAGGCAGTGAGCGAACAGTGCAACGATGATTCAGAAAGCTCATCTCGCCGCGCGAAGTCGTAGAGCTTGGGCTCTTGAAATACTCCACCTTCGACA
CACTCAGCACGAAGTATCGCGACTTCCAATTGCGCATCACACGTCCCTGCTTGTACATGCGTCCCTTTTTGATGGTTGCCGCTTGGTTATCCAAAATCAG
TTGCGCGATCGACTGGTTATCATCACCGTCATTGCCCTCGTCCTTCACAATGCGAGGATTGTTCATCAGTTTCTGCTTCACGTGAGACGTGGACTCGCGA
AGTCGAAACGACTCGGAGTGTCGAGAGTTCACACGCTGCACATCAGCCAACTTGTCCTTAGGTACAAACTGCAGCGTCTTGGGGGCCGTCGCGTTACGAA
GCACGTTCATGACCTCAAGGTACGGCATGCACAACACATCCGTCTCGTTCACCTTATACACAATATCACCGATCGAGATCATGCCGCTCGTCTTGGCTTG
ACCCTTTAACGCACGGACAACAGCGCCGTCAATACCGTAGCGAACTGCTTCCTCCAAGTTCAATCCCATCGGCCCGTTGTCGAACACCACAGCGTACGTC
GTGAGCTGGGTATCCAGATCATTGTCCTTGTTGGCCTGGAACTTGGCCCGCACAGCTTCCTGGCGTCGGCCTTCATCAATCTCAAAGGAAATGGCAAGTG
GTCGAGGCATCTTTCGGATCAAGTCAATGGCGTCGGAGAATCCCATGCCGTCCACATCCTGTCCGCCAATAGCCACGATCAGATCTCCAGCCTGCACCTT
GTTCTCCAGCAACGGGTTGTTGATGTTGTCGATGGCCAGGCCGTGGTTGATCACGCCGTCCTTGGGGGGCATGAGTTTCACGCCGAGTTTCTCCTTGGCA
GGCAGCTCGATGACCACGACCTCGGGCACCGAGTCATCTCCGCCGTTGTTCCCATCGCTGCCAGAAGGCCCCGCAGCTTCTTGTTGTTGGTCTTCCTCCT
CTGGACGCTCCGACCCGCAGGCCACACATGCCTCTTGGCCGTCCTCGTTGGCCGTGAACTCGCACGCCGTGCAGGTCCACGCCATCTTGCGTAAAATTCG
CGAGCTGACCTCTGTTAGAATATGACAACAGAGGGAGGTTAGATATCGCTCGTTAACCCTCTTCCTCGTTATAATAAGCTGGAGGGAGATCTATAAATGG
GAGGGGGGCGTACTTATTAAGGCTGGTTCTTGGCTCTCTTGGTGCTCCAGATGCTGGGGATCGCGAGGCCACTACGAGCCGTTCGCCGCGTCGGAACTGG
ACGCGTGCGCCGCCTGCTGCTCCTCCGCGCACTCGCTCACGAGGACTGCGTGTCCTCGAACTGCTTCTCTGGTCTGCGACCACCGCCGCGCGCCGCGTTT
TCCCTTTTCGCGATCGACGATGGAAGGAGACCATCACTCCCGCTAAAGAGCGGGCTAGGGGTCTTTCAATAGTAAAACAAAGATACTGGTGGCGGCCTGG
ATCCAAACGGTGAACCCTGCTTTCGTCGTGAACCAGTCGAGTCAGTGGAGACTTGGCATATACACTGCTATTGGCGTGTCGGCGTGGTTTAGCTACATGT
ATCGGGCGCTATATAGTGCTGGGCGACATTGTCGAGGCGGGCCAAAGCGCCGTAGGTAACGGGCATCTTCCGCTCTCTCTGTTAGGGCTGTCAACGTTTT
GCGTAGACTGACAACTGACAGAAAACGTTTTGTGCAGTTGTCAGTTTAGCCTAAAGTGACACAAACGGACGCTAAACTATTCAGCTATCACCAGCTGTTT
CGCACTTACCTGACGATATACCTCTGGATGATATACTCAACATTATGCGAATAGACGAGAACACGCCGAATTCTCTCTCTTAAACAAGCTGCGCCATGTC
AGCTAGAAGAGCTCGTTGCGCGCATGGGGCTGTGCATCAATGCCATCTTCATCGTCACTAGCGTGCACGATCGCTTTCATGACCTCCATCTTGAAAATGC
TGGGGTCGGGATGGCGGGAGCTTCCCGCCGGAGGGGAAAGACCTCACAACCGAGCAAGATCAGAAATGTATGAAACAAAGCATTGGATAGTTTAGTGTCA
GTCTGTGTCAGTTTTCGCGTGCAAAAACTAAACTGACAACGTTGTCAGTTTAGTTTCAGTTTGTGTCAGTTTAGCGCTAAACGTTGACAGCCCTACTCTC
TGTACGGATCGGGTGGTGGTGTGCCCGCCACGCCGCGTTTTTGGTCCGGCCTTTGCGAGCGGCGCTGTCGCAACGATCCAACGACTGGGGAATTGAAGTG
GGACGCGAGGCTCGCGTACGAGGCTCGAGTCGAGCCTCGACAGCCACTGGTGTGCAGGATAGGCTGCTGCCGATGCCTCGCAGCAATGCCATCCCATCGT
CGAGCAGCAACAATTGGGGTCTAGCGAGCGGTAAAGAGCATTGCAGCTTTTTGCCGTGTTTAGTTTGATGCCGTCAACTGCAGATGACCAAGCTTGGGTG
TACGAGGCGTAATTACGACACTATACACAGGTAGCTGTTGCTCTGAAGGTGTCCATGCAACACTGGAGACCACTGAGGCGTGTCCTATCTTGTTCCGGTG
CCAAGCGTATGGTAGATTAGGCCGTTCCGAGCAGTCGATTTGGCCAACAGCGTGAGGACCGACCTCACAGTCAGGTGCACTGTTAGACTACAACCAAATA
GTCACTTGAAGCGATTACTGAGACGAACACGAAAGCGAATGAATACTATTTATTGAATAGGCGGAGTACAGCCCCAAAGCAGATCAAGAAAGCAAACACA
AGTTGGAGGCCTCTATGGAGGGAAGCCACGAGGAAAGGCAGCTAGTTACGTGTAGAAGGACCATTGACGGCAAGAGCGCTGTTGCCGGGGCTTGCCCTTC
AACATGCGAACACAACCTATCTTATCGCATATATTTACCTACGTTCTAGCATGCGTCGCTTTCCGCACTTAGCGCCGCCCTCCATTGCTTTTGGGCGCGC
GACATTAGCTCTGCCCCCTCTCGATCTCGCCATGGCCTCCAACGACGTGGACTTTCGGGCGCTGTACCAGAGTTCGCTCAAGCTGACGACGTCCGTCGGG
GAGCTGGGCATCCCTCGTCTGGAGAAGCGCCTGGAGCAGCTGGACGACGCGTCGCGCTCGCTCAATGGCAGCCGAAAGCGGCCAGCGGCCGACAAGGCCA
ACTTCCTGCTGGCGGCCAAGGGCATCGACGCCGAAAAGCTCAGCAAGGAGCTGCAGCACTTCGAGATCGCACCCGAGTTCGAGCCCGAGACGCCGCTGGG
TGAGACGGACCTGGAGGGGTATCTGGCCCACCACCACGAGATGATCGTGCTCACGGCCATCGAGGACGTCAACCGCCGCACGGTGGAGGCCACCCACGAC
CGCATGAACCGCGCCATGATCGACGACTTCGAGGATGCCAAGCAGCAGCTGCTGGAGGACCTGGGAGGTGCCAAACAGCTCGGCATCCGCAACTACCCGC
GGTTGCTAGAGCAGGACGAAGCAGCGGGCAGCATCTTCGCTTCTGCAGCTCGCGAGAAGCGCCAGGCGCTCGAGCCGGCGTCAGGACTCGGACTTAGTGG
CGCGTCGTTTGCTGGCCAGCCCCGCTTCCAGTCCACGACGAGCTCGGCGCAGATGTCACAGCTGCAGGTGGAGAACGCCATGAGCGAGGAGATGAAGCAG
TACTACTCGGTGGTCAGGGAGCTCAACAGCAGCCGCGTGCCCAACACGCGCAGTCAGTTTGAACTGGCGCGTTATTTCCAGCGGCTGTGCGCGTCAAACG
TGTCGATCTCGGTGACGGGCTCCAAATGGGAGGCTGTGCTCAAGTGCTGGCAGCTCGTGAACGACATGCTGGTGGGTGGAGATGCCACGAAGCCGAACGC
GGCGAAGCTGGCTCAGCGCGAGTTTGCAGGTGTGAGAAACGGAAGCGATGAAACACAGCGGAAGCTGCTCCAGCACCGCTTTGCTTTTGGCGCCCGTGTG
TTCCTTGAGAACCAATTCCGTGCGTTCATGCAGGAAACCGTGCAGAAAAACAACCTTGCTACCGGCGGAATTCCGGACCTAGTGTCCACAGTGCGTGCTT
TTGTGAAGCACCTGCACAGCTCGCGCTATGCTGCCAACGGAAGCGGCAGCAATACTGATGTGGACAATATTTGGGCCATTGTGTACTACTGCCTCCGCTG
CGGTGGCGACCAGGAGGCTGTCGATCTCGTGACTAGCCTGGCAAACGCCAGTGACTCGGATTCCCCGATTGACGCCGACGTGCTTTGTGCGTTACGATAC
CGTGCACACCAGAAGAGTCTGTATGAGGATCGCAACGCCAACCCGTTGAACGCGTTCTCGAAGCAGTTCCCTGCTGAATTCGACCATTTGGTCGACCGCT
ACCACCGCTTGATGAGTTCTTCGATTGACGCAGTCCCTGTTATAAACCCGTTCGAGCGCTGCGTTGTTAACCTGCTGTGCTTTGGCAACGTCAACGCGAA
TGAGGCGCGTATCATGACAACTGTAGAGGACTACCTGTGGCAGCGCCTCTGCTTCATCCAGCGCGTGGCAACTACTTGCTCTTCTTCGGACAGCACTTAC
ACGATTGCCACATTGTCCAGGAGCATCCAGAAGTTTGGCCCCACGCACTTTGAAGGCGGGGTGCAGCCTGGAGGTGGTAACTTCTCCGCGTTCCTGTACT
TCGAAATCCTGCTTATCACGCAAGAGTACGAGAAGGCAATTAAATATCTGGCGTCTAAGGGCTTTCTACTGGAAGCAGTGCACTTTGCGATCACACTGAA
CCACTATGGACTGTTGGAGTGCACGTCATTCTCAATGGGAGAAGAAGACCAAACGACTGTCGATTTGGTGCGCCTCATTCGCCAATACATCCATGGCTTC
CAGCGAGCCAACGCCGCTGAGGCAGCAGACTACGTGGCGTGCATCTCGGAGCTGACTGCGAAGAAGGAGTTACTTGCGGAGCTGCTGCTCGACACGCGCA
AGTTCGATGTGCTGGCTGGATTCACAAACAGCACAGACGGCTCGCGCACTCGTGGCTTGTACGACCACCTTCTGAAGGATGAGCCTGAAGATGAGGTCAA
GGAACTGATTCTCTCGGCTGCGCGTAAGGCTGAGGCTCGTGGCCGCCCGCACGATGCGTTCGCTCTGTTGAAGAGCGCCGGCGACATCGAAGGTGTCATC
GCTCTGCTCAACTCGCAGCTCAGTTCGACTCTTTCGGCCCCACGACCAGAGCGTGAGGAGTGGTTCCGTGAGGCAAAGGAGTTTGCCGAGAAATGGATGC
GTTTCCCGTGGGTCCAGGCTATCGCTAACCGGCTTGCGCGCACGGCTGCCATTGCATTCCAGACACTTTTGAACATCAGCATTTTCCTTGAGATGTTCGA
GAAGCAGCAGTACGAGGACGCTATCACGTTTGTTGCTGAGCTGGAGGTTGTGCCTACACAGAACTCAAGCAATCTGGCGCTCTGTGTGGATCGCTTCCTT
GCCTTCGACGAGAGTGTCCGACAGAACTTCCACATATTGCTGCTCGGGTATATGGAGTGTCTCGTTCGCGATGCTGACCGCCTGAAGTCCCAGGTTTCAG
GTGAGATACGGCGTGCTGGTGTCGGTGCTTTGCGTGAGAAGGCCGAGCTCCTCGTCACATTCGCAGGCATGATCAAGTTCCGGCTCCCGTCGGGCACCAA
CGAGCGGCTGAACCGCATGGAGGCCATGATCTATTAGAATGTGTGACCGCGCACAGGAAAATCATTTACGACCGTCGATGAGATGTACGAGAAGCAAACA
ACGAACACACATAGTTCGAAACGAAGGGTTTTCCGGGCTACAACTACACTGTCAGTCTCTCTTTTCGCTGGTCTACTTGCTACTTCTTACGGCCAAAATA
AATCTTGCATGCTTTGGCTTCATGCTTCGTCACGTCTTACAATGCTCTGCTGCCGGCAGCCAAGTATCATGGTTAAATTACCGCAGCGGCGCCTGGCGCT
GGGAGAATAGCCGTGAGGCGTTCGACGAGAACTGGAACTTGCTCGGCGATGTCCGAGATAAGAACCTGGTCGACGCACTGGGCTGCATCAGGTGGTCACC
TCGATTGGTGACGAACGCGAACGACTTGCGGGCGTCGAAAGCCGGAGCTGCCGCTGCGTTCGAGAAGTGGACAGATCGGGCACTGCTGGATTTCCTTCAA
TGCGGGGCTTTCTCAGCACGAGCACCTTCTCCGCACTGCTCTCTCCTGTTCTTGCACGCTTGATGGCCGCCTTCCGAGGCGTCCGAATGCGCGTAGGTCT
CGACAGTTGGTTCACGTTAGCAGTAGAAGGTGCAGGCAGCGAGCTCGTGAACGCCGTCGTCGCGGACGAAGACGCTGCAGACGAGAAGAAGGTGATGGGT
CTGCCTGTTCCCTGCTGTGGTGCTGCCCGAGTCGAGGCTGCTGACGTCGTGGGGGCCGGCCATGTGAGGTCGCGCTCTGCGCTGGGTGGCTCCTCGCTGG
TGCCGAACCCCTGGAAGAAACGCTGGTGGGTTGACTCGTGCGACGCGCGCTCAATGCGCTGGCCCAAATTGGTGCACCGGATCTTGGCGGGCGTGACCTG
CGCCGCGGGCATGTCGAGTGCGCGTTTGGTGCGGCGTCTGGTGGCGCCTGGTCCGTACGCCACGCGGATGCACGCCCGCACGAGCCGCAACCGCTCCTCG
CCGGCGGAGTCCATGGGAGAGAACATGAAGTCGTCGCTCTGCATGCTGCGGGTGTGGAGGGAGGGGTGAGCGGCAAGCCGAGATAGGGGAAACGTTGAGA
GAAGTGACACCAGCCCTACTTGACGTGGTCTTGGCAAATGGAGAAATGGTGGTGGATGGCCGCGTTTGAATTTCAAACGTTTGAACTTTAATGTGAATGT
TTGGGTAGATTATATGAAAGTTGGGCTCTAACATTTGTTTCTATTTTTACTGAATTTCTATGTTGTTTGTGGTGTGGGGTACACAACGGCAAGTTGAAGT
GAGCCAAACGTCTGCGACCCAGCGTTCATCTTTCTCGTCCTTGTTCCTCCAGTTGAGATTTCCCTGCCAAATAAATCAAAGAGAGGCTTGTCATGGTGAA
GGCGGAGGAGGCGATTTCGGAGCTGCTGATGAAGTGTGACGAGAAGGGCATTCAGTCTCCGGAGGTTTGTGGTTTTGTTGTCTAGTCCATTGTGTCACTG
TCGCTAACCATTCAGTATCCCACCCTGTAGAACCCGTGGCAAGCGTTGCGCGAGGCGATCGCGGCGCTCCGGAACACCAAGGACCAGGCACTGGGGTGCC
TGCAAGTATCGAACGCTCTCGAGCACCTGGCGAACAAGTTTGGCACGGAGGATGGAGTAGCGCGGGAGGCAGCTGCAATGGCGCCTTCTCCTCGGGTTGT
GCGCACGCAGAAGCGGACGCTCATGCAAGACATGCCCAAGCGCAACCGCCGCAACATGATTCTTGAGAGTGACAGCAGCGACGAAAGTTCAAGCGGTCAG
TCGGAACTCATGACCGCCATGAGCCCCGTCGCGAGCAGCAAGAAGAAGAAGTACGCGAAGAAGATCCGCCTGCAAGAGCAAGTGGAGGCCAACCCCGCCG
CGAGAAACGAGAATCAGCCGCTCGTGGACCAACTGGTGCAGTTGGGCGAGTACGAAATGCGCCACGGCAAGACTCAGCGAGGGCTTGCGCGCTGCGCGCT
GCTAAGGAAATCCGAGACAGCAGGATGGTAATTACAACGGGGGCTCAAGCGCGGCAGCTTGATCACGTGGGCCCGTCGGTAGCCACAAAAATCGATCAGC
TCCTGAATGAAGGGCTCGTGGCTGCACTGAGTGAGTACGAAGGTGACGCAGAGGCTATGCCCGTGGCGAAGTAAGTCATCCAAGCATGCATTTTTAAGGA
TATGAGTTAGGAGACAAAGACAAATGGTGGACATCAGTGGAATATAAGGCGTTTTACGATGCCCGCGTCCCAGTTGTTGCGACCAACTGTCTTTGCCCAG
CAGAATCCAAGAGAGACCGACGATGAATCTTCGCCAAGCACAGCGCTCGCTCGCCGAGCTGATCTCCAAGTGCGAAGCCGCGCATATTCAGCTACCGAAG
GTTGCTTTGTATGACCTACCTGAACCGTTAGTTCTATAGTTCTATAGTAACGTCATTCGTTGCTAATCACAGGATTCCTTGGAAGCGCGCTCTGAAGCTG
TGGAAAGCATTATTCACTCGTTAAAGGACGGAAAGGTAATGAGTGAACATCTTACAGGGACTCTGTCGCCACTTGTCAACCATTTCTTCCATGTACAGCC
AGACTTGAAGGCTGCACAAGAAGAACTTCAGCAGAAATATGGCATCGAGCTGGTGTGGAAGCAGCACATGGAAAATGAAGAAGCCAAGCGCCAACGTCGT
CGCCAATCCCGCCAGAAAAAATGTGGCGGAGGAAAGACAGCCCCGAGTCCTTCGCAAGGGTCCATGAACCTCGGACTCCTCCCAGAAATGCCCGCACGGT
TGGAAGTGAAAGCTCCCACCGTGCTAAATCTCGCAGGTGGAGAGCCTTTACAGGGTACAATGAAAAACGTCCCCATAGGTGGTGTGGTGACTCTGTCCAA
GCGCCCGGCTGCTAGCCAAGAAACACCACACGTTGGGATGAAAATCGCCAAAAAGGCGAAAAGCACACAGGGGTTGATTGTATCGACAGCTCCGAGCGAT
ACGGAGGAAAAACCACCCCCGAGATCTGCAGCAGCACTAGGAAATATTCTCAGTGAGGATAACGATGACAATAACGAGAGCGCATCGTCTGGAAATCCTG
ACCATGATATTGTTGACCTACTGGACCTGGAAGATTTGAACGAAGTTGAGAGAGGCGGTGGCATGAGCAGCGATGAAGAGTTTGCTCTGTAAACTTTGTG
ACGGGTGCTCAGTCCATCAATTCGGGCTAATCGGAAATGGCACCGTCTTCTACTTCACCGGATTCCACCGACGAGGAAGATTGGGCGAGGACTTGCCGGC
GAAAGTTTGAGTGAGCTTTCATCTACGTACATGCACAAGGGAAAAGGTGCAAAGTGAGTTTTCGACAGCGTAAGAGCAACATTGAGATAATCCACATAAC
ACCTTGACAAGTACTCACCAGTGTTGGAAGCTCTCCGGATTCTACCGAGTTGAGTAAGCTGCCATTGCCACCCATCATACTTGAATTTGTGTCCTTCTGG
TTACAATATTTCCTCTTGCATTCGCCAAAAATCTCGCCATCACTGAGGTCCAACGCTTCTTCACGCGAAAGCTCTCCCTCTGACAGCTCAGCACTGCAGA
TAGAATCTGGTACACTGCTACCAGAAACCGATAAGCGTCTTCGTTGCCGTTGCGGACGTCGACGCCGAAAGGATCTAGCGCGAAGCTGGTGACGATCAAT
TTCTCGGTGTATGCTGGACTTGTGCTGATAGTCTGAGGTCGAGCTGAAGAGACTACTGATCACTGAAACACTTCTCGAAGCAATCTCCAAACTATTTTCA
CTACTCGCGATGTCGTTCACGTTCAGCACCTTTTCCGTGAGAGGCACTGGCTCTGTTGTTGGCAAAGGCAGTAGAATATCTCTATCTCGTTTCCCAGCTT
CGTGCTCGGGTTTGTGACCTTGCTCCCAGTTTTCACTCTCGGATATAGTACTTTTGCATTCGTCTTCCGAAGAAAGCAGATTTTCACTGCCTAGCAAATC
AATGCTCGTATTGCTTTGCTCGCGATGGATTGAAGGCCTTGGCTCTTGACTAGGTTTCATCGCTTCGTCACTAAATGGCTTCATGTATTGCTCGGCAAGT
TTGCTTTGGTGAATACGCCTTTCCTGACGAAGACGCTGCAAAACCTCAATTGAAGTTACGGTACCGAATAATTCGTGTGAATCGTTACTGTCTCGCAGTG
AAGGCCCAAGAGCCCTAATGAAATGTGTTCGAGAGAAACGCATTGGCTGGGAACTCGTAAGATCTGCTGGAGGAGAGACTGCTGCATCTTCATGTTTTTC
CTCAGGAATAACAGCAACTTCAGGTTGAAGGGCGAGTATGGACTCTTCCTCCACGCCAGAACTTGTGCCCCCGATTCAGTTGCGACAGCTGAGATGTCGG
TTGTATCCGTAGCTTCGCCTACCCATTTCATGGTTTGATCTTTTGGTTCTTCTGTGAGGTTCTCGATACTCATTGCCCCTGCAGTTTCCAGAGGTGCTTG
ATAAAGGTTCATCTGTCTGTCTTTCCAAATCTGCTGCACTAAGCCACTCACTTGCTCTTCTGTAAGTATGTTCGCCCAGTTCACTAAATCATCGGAGATC
GCGTCTTCAGCGGCAGAGTTGGTTTCGAGATCACCATACTGCGTTTGGCCATTGTAGTACGCGGCAGCTCTTCTTAAACCTGTGACGTCCTCCTTATCTT
CCTGGTTGAAGGTTCCAATGTTGCGAATTCTCTCTCTAAGCAACTCTTGGGTAATTTTGCAGACCAGCTGCTCGTCGACTGCTTCTTTTCCAGCAAGTGA
TTCCAAGCTTCTCCGCACTACGGAAACAGCAGCTTTTCTGGCCTCCACGTTGACTGAATGCGGAATGTCTGTAAGTATCCTGTTGACTAAGAATTCAGGT
ATTTCCTTCATCACTCTTTCCTCAAACGCTGCAATTCTCTCTTCAGGACGAACAGTATCAACTTCGTAAACTCGGACTTCTTGATCTATCATCGGTGGTT
GGGGCTCGCGTGCATGTCGCTTCAGCATCGAGGAGCTGTTTGGTTGTGAAAATATCGGCAAAAGTGTCGACGGCGCGGACAACACCGGGATCCTGGAGTG
ACTCTCCTTCTTCACTTTCGTTTGGACGGCAGTTCTACTTCGTTGCGCTTTTTGCTGCTGTTGTTGGTCATAGGCAGCGGTAACAAAGGCTACGAACTCC
TTGTAGTTTATCACCTCTTTCATTGGCAAATGTTGGTTGGTACGGCTACGGACAGCATTTCCATCCGATGAAGAGTGGATGTGGCGAAAGAAAGATATAA
TCTTGGTGGTCGGGACAGAAATCTGCAAACGATGGAGGGCCATGCACGTCTCGATACGATTCACACATGACCATCTTTATCGGTATCCAAGTCGCCAAAG
AGCCGGCGAAGAACGTCAGCGTTCAAGCGCATATCTCCAGGATTCCCAAGACCCCCGGCAGAAAGAACTGGGCGGGCACCAAATGACGCAACCGATGGCA
TAGTACGAAATTCCGACAAAACTTGTCTGCCAATGGAAGATGACGGACGATCGTCCGTGTGTACTCGACGAGGACTAATTTCTTCGACCATCAACATGTC
CCCAGCACCACTATCGTGACGAATACTTGCGGCTGTCTTCGTTTCTCTCTGATGCACGCTTTTCACTGGAGAGCTACAATTTTGCCGAGAATCTTTCGGT
TTTGCTTCGTCAAGCGGACTCAGTACTGCGTTCCCAGCCGGCTTAGCAAGACCCACCGGGCTTACAGTCTTGTCACCTCCTTTCACATCTTCATCCAAGT
CCAGATCATCGTGCGGCTCGTTAGGCAATAGCTTGGTCGAATTGGCACTACCCCTAAAAGGCGAATCTGTATCACCAACAGCCCCAAACGCTGCTCTGGG
CGCTACATTCTGCTTTGCGTTCTCTTTATCCTCACCAGCAACAGGACGGGGGCTCGTTCCTACGTGCTTCATCACCTTCCTCTCCTCAGCAATCTCCGGT
TTCCCCCACAATCGTTTCTCGCTCTGATTTACTCTAGTAACTCCATTTCTCGTCAATCGCTCCAGTGGTGGCTGCACCCCAATTTCCCCCCCACAGCAGT
TCCGACCATTCCTATTTGGCCCCCTCCCAACACCCCCGCTCTATCCTTTCGCTGCCGATACGGGAGCGCCGTCTCCTTCCTCTTCTGGTTCCAGAACCTC
TGCGCTGGAGGATATTGCTGCAGCTCTCGGTCCACGCGCGCGATGCGTCTCGCCACCTCCCACTCCACGCGGCGTTTGTATCGTCGACTGACCTGCAGAC
TCGCGTTCCCTTCCAGAGCCACGAGCATTTGATCCGCCTCGCCCGTGGCCGACTGTTCGGCCTGCGAGTGCAATCCGCCGCCGCGCCGTCTCCGGGGCGC
GGCGCTCTTCATCACCAACGCATTGTCCGTCCAGAGCATCGGCAAACTACTGCGGAGACGCATCTGCAGCGCGCGGTTCCGGGCGCTCACGTCGCTCAAC
AGCGCGTAGCTGACGTCGAGCGACCGATCCATGACTTGGCAGATGGCTGCGAAAGTTGAAGTGTCAACCGGTAGAGAACCGGTAATGTACCATAAAATAG
GCACATTTGACGCGACCGTCGTCACCGAAAACGTCCTGCATTTCTCTGCGTTCTCGATCCCCAATCAACCATGCGATGCAGTGCATGTTTATCGCTGCAA
ACAAATTGCCCGCAACACACACGTGTCTGCAGACACCTCTTGTGAACTGGTGGCGCAGTGCCTTGCAGATTCCATTGCGACTTCGTAGTCGCTGATTGGC
TGACGTGTCTGTGTGGCACACATAGACTGTCCCATCTGCTCATCCCTGTTTGGCAGCCAGCGTTACCGGGGGCTTTCGCGCCGTCAGTTGCGAACGTCGC
TCGCTACAGCATCTCGGTCGCCATGTTGAGGACAGCACGCTGCCGCCTGCCGGTACGAGCGGCGTCCACTGTCCGCCACAACAGCAGTACTAGCACTAGC
AGCATCCGCCTCCCCCGCCTCTCGGACCTCGTGCTCATACGGCACGGAGAGAGCGAAGGCAACGTGGCCAGGCAGCGCTCGCTGGCCGGAGACCACAGCC
TCTTCGCGGGCGAGTTCAAGCACCGCCACAGCTCCAACTGGCGCCTCACGGACCGAGGCCGGCGGCAGGCGGCGGCTGCTGGTGATTGGCTTAAACGCAA
CAACCTGGCGCACTTCGACCGCTACCTCGTGTCCGAGTATCTGCGTGCCATGGAGACTGCTGGCCGCATGGGGCTGCCCGACGCGCGCTGGTACGCGGAG
ATGCTCATCCGCGAGCGCGACTGGGGCGCTATGGACCTCATGAGTGAGCAGGAGCGCTTCGTCAAGATGCAGGACGAGCTCAAGCGCCGAGAACTCAACC
GCTTCTACTACGCACCGCCCGGAGGCGAGTCGCTGGCCGCGGTGGCCCAACGGGCGGACCGGCTGCTGGGTATATTGAACCACGAGTGTCACGACAAACG
AGCGATTGTCGTGGCCCACGGAGAAGTGATCTGGGCCATGCGCACGCGGCTGGAGAGGATGTCCCAGGATACGTTCATTGAGTTACAGGAGTCGGGGCGC
ATGGTAGACCAGATCCACAACGGCCACATCTTGCATTACACCAGGAAAGACCCGCAGACAGGAAAAATGGCTCCGTTCTTCACGCACGTGCGGTCCGTGT
GTCCGTGGAACGAGAAGCTCAGTCCCAAGGGATGGATGAAGATCGACCGACCTGTGTACGACAACGAGCTGTTGCTTGCTACTGCTGAGCGTGTCCCACG
TATGATCATCTCGGAGGAATATCTCGAGAAGACGTATAACGGTGCCAAGACGTTATCCGATGCAGATATGAACTCGGACGTATTGGCGCATTCGACGAGT
TTGAGCCAGGCGTCCTCGGGCACCGAAGGAACCACCACGACGGCTGGTACTTCGTCCAAGAAGGAAGAGCGCCAAACGCCGCTTTTGATCCCTGGAAAGC
CCATGCTGAACCTGAAGAAGGTGGTCGTGGTGAAAAAGACGTCTCGCTTCCAGCACGAAGCTGAGTTGTACGGCAACACAGAGTAAGTTGACGTAGCCTG
CTTCTGTGTGTCTGTTTACGTTACTGACGCTTGCTGCTTCGCATGGTATTTTGATGTTCGGTATTCAGTGAAGCGCTGAGGAAGCAGATGTCGATGCGAG
GCTTTGTGCATGACCGTTTGAAGGCGAGTCACGAGCATCACGTCGAGGCTGTGGACGAAATCACCAGCAGGTACAGCTCTTGTTTTAATCTGCGTGCGCT
CCCTGTGCCCTGACGCCTGACTTGGTTTGGGCAATGATACAGCTTCAAGGAGCGCGACATCGAGGTGAAGGTCGTCTCAGCAAACCAGCTTACGCACGAA
GCAGTGGAGGGAACCGACATGATCTTTTCTGCGGGTGGTGATGGCACATTCTTAAAGACTGCAAGCTTCGTAAACACTCCGACCCCTGTGGCCGGCTTGA
ATACAGACCCCAAGCGGAGTGAGGGAAACCTGTGCTGCTACAAGGTGGATAATGTCACTCACCGATTTAGTACGGCACTGGACCGCCTACTGGAGGGCGA
CTTCAAGTGGCGACTGCGCCAGCGTATTCGTGTCGGTATGGTCAACCAGGATGGCTACTGGTATGAGCTGCCTCGGTATGCGCTGAATGAAGTGTTCATC
GCGGAAAGTGATGCATCTCGCCCATCTCACTACAATATCGGTATCGATCAGCACCAGCGTGAATCCCACCGCAGCAGTGGCATTCTCATGTGCACAGGAA
CAGGTTCAAGCGCGTGGTACTCGAGCGCGGTAAGTGAGGATGCCTTTCAATGGGGTTGGCTCCTAACTAACGAGCGTCTGTCTTTCAGTGCCAAGTCTAT
CGAGAGCAGGTTGCAAACGTCCTTAGCGCGATGAACCACACGCACACGAATGAGACGGTGACGGAGCTGACAGAATCGTACGTTTTTTCTCTGCTGCAGC
TTCAGTGGGGACAACCAAGTGTTGGTGTGGCTAATAGGTTGTTGTTGTTGTTGTTGTGTTCCCGTGCTCGCAGTATAAACAAGCAGAATGTTTTTCCGGA
AGACTCGCGGGACATGGGCTACATCGTGCGCGAGCCGATTATTAATGCTACATTCGGTGATATCCGGTTTAGACGGTTAGTTCTCGTGCTTGGCAAACTT
TCATGTGCAAGCGTGCTTATGTTATTTTTTGCTGTTTGCAGAGGCAAAGCTCGCCGAGTTTCTATGCGATCCCTTGGGTGGGATATGAAGGTCAACATCG
ATGGCATCTACTCGGTGCCGCTAGATTACGGCGTCCAGGCGGTTATGAAGATCGTTGACGAGCCAAAGTATGTGCTGCGCACCGTGGACTTCTCCCCGCT
ACCAGGCTCAGCGCCCAAGAAGAACATATTTTAGATTCAGCAGATACCAACCAGTTTTGGAAATGTCAATACTCATTCAATTACACGACGCCTTGGCAAC
CCGAACTTCAATTTGGCAGACATTTTATTGTTGTTTGTAGGGGTCAAGCAACTAAACCTACCGGCGAGATCTGGAGCGAGAAGAGTGGCGGCGATGGTGT
CGAGAAGACCTCCGAGACGATCGCGAACGTGAACGCGATCGTGACGACGATTCTGAACGTCGCCGGCTGCGATGGCTCCTCTCTCGCCCACGCGACGGCG
ATCGGCTGTCGCTACGACTGCATCTACGACGTGAGTGGCGATCATGGTGTGCATGACGTGGCTCTCGTCGTGGACTTGGTGTGTAACCCTTTGACTCTTC
CCGCCCTTGTGCCGGTGAATAACGCCTTGAATGCGAGCGCTCCAGTTCCTTCGCATTGACTTCTTCTCGTGTAGTAGTGCGTGCCATTCGTGCTACGAGC
TCCTCAAAGACCTGCTTCTGCTTCTGTGCAGACAGCAGTGCTGCAGGCTCACCGCCTGACGCTGCGGAGCTGTAAAATGCACGGACTAGTTGCTGAACCT
CGTCGCTCTCCCATTGCGTCGTCAGCTTATCCGGTGAAGCCAGCTTTTCCTCAAGAAACTTGGTGAGGCGTAGTTGCTCTCCGTCGCGCTTGAGTGCTTC
GGACTTGTATTCTGCAACCGCCTTGGCATAAATCTTTTCCTGGGCGGACAGTGTCAACAACGCAAGTGCATCGTCTTGAATCTGTTGTATCGCCCAGGTT
CAACATTACCTTCCAGCGTCGAAATAAACACGCTCACGTAGTGTTGGGCGCCCACGAGTCGAGCTGGAACTGCTCACGCAGCAACTGCGTGAAGAGATGT
CTGGCCTGCTTCAATTTGTTTTTCTTCTCTACCTTGAGATCTCTCGACGGTGCTCGATGAAGTGCTCAAAAATCGCGCGTCGCTCGTCCATCGTCGGCAC
GCCCATAAAGCGCGGGTCTCCAGCAATCTGCGGCAGTGCCACGGACCACTTGCAGAACGGCATGATGTTCTTGTCGCGCAGCATGGCACGAAACTGCTCG
GTGCGTTTTTGCTCACGATCCTTGCGCTCCTGCTCCGCCTGCAACTCCTCTGCTGTCAATGGTTCTTCCTCTTCAACGTCTTCCTGAGTTGGTTTCTCCT
CCTTTGCTTTTCCATCTCCTTTTGCTTCTTTTGCTTTTTGTGCTTCTTCTTCTCTTTCTTGACCATCTTCTCCACCTTTGGCACTTGCTCACTAGCTATC
GTTTCCACTATTTGCTCCTTTTCGCGCTGCGCTGCAGCCTTCTCTGCCTCGACCTGTCCCCATTCACTGGGCCGCTCCCACGCCGACTCGCGTGTCTTCG
AGTTGAAGTAATACAGCGTCCCGTTTCCGGCGTCATGGGCCGTCCACGTGCTAGAGTGAGCAACAGCGTTCTGCACCATGAGCTTCATCATGAAGGCGGT
CTCAAGCGGCACGAGGTCCTCGGGCAGCTCCCACTGGGACACATCCGTCTTGCGGTCGTAGTAGAAGAGCCGTCCGTCGCCGTCGTCGTGCACGGACCAG
TCGCCCACCACCTGCAGCGCATTGAGCCAGTACAGCTTCTGCTCCGCCGTCATTTCGGCGTCGCTGCATGTAGCCGACGGCAGAGGCACCGAGAGTTCCT
CGTCACCCATCGCGCCAAAATGCACTTCGTGTGGTGCACACATCATATATAGTGTGGTGCACCTGTTAAAAATGAGTCAGCTCCAGCCATTGCCGACCAG
AATCAGACGTGCAGCTCACTTCGATGGCGGCTCCGGCTCCGGGGCGCGCGCCAACGGCGAAGCGCCGCTTTCTGACGGACGAGGAGTACGAGGAGAGCAG
CTGCTGCTGGACCTGGAAACGGAGCTCCGGCAGGTGCAGGCGCTCAAGGCGCAGACGCAGGAGCGATTGCAGCAGCTGGCGCTGGACCAGAGGCAGCTGG
AGCAGCAGCATCGGCGCCTGCAGCGCCAAACTGACCGACATGACGCCGGCGCCGCCACCGCGCGCATGCTTCAACTGCAGGAAAAAGAGCGGGAGCGACT
CACAGCAGCGGAGGTCCAGCGCGAGCGCGAGGAAAAGGAAGCGACGGCCAAAGCGGAGGACACGGCGCGACGCCGAGAGAACGCGATCGAAACGCTGGAG
GGCGACATGGAGGACCTGGACGCCTTTTTGGCGCAAGACGCCGCGAATTTCTGAAGTTGCGAGAATATTTATTGCCGACGAAATCAGTGGTGTTTGGAGA
AGTTTCTGCGGCTGTTGTTGCCTTTTTCTCGCTTTGCATGTAGGCTTTGCGGCGGCAGCGGAGACCGCTGAAATCAGTGGTGGTCATGTCATCTGCTTGA
TAGTGCGATCTCTCGTGCCCCGCTGGTCGACGAGTACAGTGAGTGAGTACGCTGTACTCTTGTGCAGCAGCATATGGGTCAGCGTCTTCAGCGCCATGGA
ACCCTTTGGCCATCGGCTCTGCAGCGACGAGGGCACCGAGCCGCCATTTGGCCGCGTCTTATTCACTCCGGTTATCGACCACATCTGGTGGCCTCGCCGC
TGTCTGAGTCGGGTCGGTGCTGACTGGCTTCAGTTAAGCGCCTCGGCGATCAGATGGCGGAGAAGATGTCAACCACTTCAACATGGGCCTCGGATCGCGT
GCGCTGCTGCTACAGGGTGGTGGCTGGTAGCGACGGTTCTTTGCCGCTGCTGCTCAGAGTACATGCATGTACCAGGCTGCAGGATGCGCTGTGAACGCCG
CTTGGTGGCGAGCTTGTTACCAGCCTCGGTGTCCGTCAACCGGATGAGGCCAGTTGCGGTGAGGAGTGATCTTCCTCGCTGCACTCGCCTCACCCAGCGC
TAGGAAAGGCCCTTGCATCACACAGACACAAATGCGCTCTTCCTCTTTCGAATGGTGGCGAGTGCCGTGGCCGCACCAACCTGCATCGGAGTCAGTTCCG
AGGGAATCCAAGTGAGACGACACATGATTGGCCGAAAATCCGTTCACGCGTCGCTACCACTGGCTAAAAAGAATTGCCTGAGTTCTGAGCGAGGCCAAAC
AAACCAAATCGAGCCCCCCTCGAAACCCGCAAACACAACACAAAAAGCCCGAGGAAAGGTGCTCCTCGACACTTGGGAAGAATCGCAAAGCCAACCCGAC
CCCCCTCCTCAAAAGCCGAGACCATCACTCCTGTCCGCACTAACACGCGATGGAGACCGCCCCCACCAAGGACATGAGCGACACGAGCAACCGCAAGCGC
AAGATGACGGCCACCACGCCGCCGCCGGGCCTCAAACGCGGCAGTAAGCTGTCGCGCCCAGCAGCGGCCGTAGGCGCCAGCATCTCGAACGGCGTGACGC
CTCCCGTCGTGACCCCTCAGGGCTCTATCCACACGTCGGAGCAGTTCATGAACCACCAGCGCGCCATGTTCAGCGCCCCCACGCCGCACGGGCCCGTGTC
GCAGATGCCGCCCACGCCCGCCTTCGTGAACCGCAACGGCTTAGCCACACGCCCGACGGCTTCTCATCCACACCCAGCGACGGCTTCCCGTCCAACTCGG
CTCAGCCGACAGCCGCTGGGACCTCCACGCCCGCGGACGACAACCAGGCGGGCCCCCACTCGTCGCACGCGGCCACACCGTCGCCTGTACCCCGCGCGGC
GCCGCTCAACTTGCGCAACTTTGCCAACTGGGAAGTCGGGACCCGCTATACGCTCGTGCGGCTGCTCGGCAAGGGATCTTATGGACAGGTACGGCCACGA
GCTCAGTAGAAGAGGCGGTAGAGGAGGTTCTGAGATCTGTTGTTCTTTTATGTGGTGGTCTATTATGTAGGTCGCTGAAGCGTTCGATACCGAGCGCCAA
AGAAGGTGGCTATCAAGAAGATCATCAACGTCTTCGACCAGGAGATCGACTGCAAGCGGCTGTACCGTGAGATCTATATCTTGCGTCGCCTGAAGTGAGT
AGCGGCTATTGCTAGGTTGTTATCGTGGCGTTGCTGACTGACTTTTGTTGTTTATTGGTGTGGTAGCCACCCGCAAGTGATCAACCTGATCGATGTGATC
CCACCAGAGAACTACGACACGTTTACGGACCTGTACTTGGTGTTCGACTTCGTGGACACGGACCTGCACAAACTCATCATGAGCCCGCAGTACTTGACTA
TTCGTCACATCCAGGTCTTCCTATACCAGCTTCTGTGCGGGCTGAAGTACGTCCACTCGGCCAACGTGATTCACCGTGATATGAAACCTGCCAACATCCT
ACTGAACGAAGACTGCACACTTATGGTTCGTTCCTGCTACATTGCTTCTAAAATGGTTTAGTCGTGTCTAATGTTTTCCTGTTTGTTATGGCACGCTAGA
TCTGCGACTTTGGACTCTCTCGTGTGATGGAGAGCGATATGTCAATGGAGGAGCTGAGCAAGCACCTTTATTCACCCAAGGACTCCAAGTCGCCTACCAC
ATCTGATGGAGGAACCACGTCGGCGCCCTCTCCCGGAAGCGCGTCCTCGACGCCATCATCCTCTGGAGAATTCCCGAAGATGCGTCGCCAATTGACGAAG
CATGTGGTCACGCGGTGGTACCGTGCGCCGGAGCTCATTCTCCTTCAAGATTACGACTTCTCAGTCGACATGTGGAGCGTCGGGTGCATTTTTGCAGAGC
TGCTGAGCATGCAGGTCGAAAGCTGCCCGCGGTACCAGGAGCGCGTGCCTCTCTTCCCTGGGCGCTCGTGCTTCCCGCTTAGCGCAGACCGACCCACTAC
TTACTCGGACAAATTAGACCAGCTCAACGTGATTTTCAACGTGATCGGCACGCCTGGCGAGGATGACATTGGCAGCTTGGGTGAGGTCAAGCAGTATTTG
CGAAAACTGCCTAAGAAGGACCCCCGGGACCTTCGTGAGGTATGTACTGTCTTCTGTACGTGGATCTGAGTGGGAGCTGTACTGACTTGTTTGCGTGTGA
ACTTATTCAGATGTATCCTGGCGCCCCAGCCGACTCGCTGGACTTGCTTAAGCACATGCTATCATTTAACCCAGAGTGCCGAATTTCGGTAAGCAAAAGT
GTTGCAGTACCGCATCAAATCCTATCTAACCACAATCTCTGTATCATCTAGGTCGACAAAGCGTTGGCACACCCGTTCCTAGATTCTGTACGGAGGTCTC
AGTCGGAAACTGTAGAAGCTAACCCGTTTGGCATGGAGTTTGAGAAACGTCCCCCTGAACAAGGAGGCCTTGAAAGGTTCGTGCTTGATATTAATTTGAC
GGCTAAAGTACATGATGCTGATTTGTGTCTTTGTTTCATATGCGCAGCTCGTATCTTCGAGGAAATCAAATTGTTTGCGGACCGCAACAACCGGAGATGA
ATGAAGTCTCTGTGATCTGTTCGACCGCAACGAGACAAGCGTCACCCAGCTCCGTCATCGACGCGCTCCACGTGAAGATAGATCCGGGCGAAGTGGTAAA
CGCCGGTGTTCACCATCGGTGAGTGTCGGTTAGTTTGAGTGTACAGTGTGAGGAAAGGAAAGCAAGAACGAAATGGCGTGTGGAGTACAATGAAGCTACA
AGTCAAATGGCGACCGTCTTTATGACAGCAAGTTCCTCGAAGAGAAGAGGAGTTTTGTGCGAGCCAGCCCGGTAGTGGTTGTAGGGGCACACGTATTCGT
TCTTGTGGCACATGCAGTATAAAGGCAAGAGGCTGACGGAAGAACATACGGAAAGCCAAGAGTAAAAGTAAGTGGTTGCCCGTTTTCGCTTGCCTGGAGA
CTGCAACGAAGCCGAAGTAGCGGGCGTGTTGCCTTGATATGCTTGAAGTGTCGTGTGTGTTTTCAATAGATAAAAAGAAAATTGATTTGGTGGAGGCGTT
GGTGCCGTTGACATTCGTTACAACTTTATTTTTGCTTTCCTAGTCAGCGGAGTGTTGTTTCAAAACGGACATTGAAGTACTCCGGCGATGGGATTGACGA
CAATCACTTGCTGAACAACAAACCGATGCTAAACCCTCCACAGACCTGGTCGAAGTTCGCAGTGCTCACCTGACACCGCCAACTGCTTCGGTATTTGATC
ACCGCGTACGTTTACTTACTTATACATGATGGAGACCAGCGTGGATACTCTCGTGTACCAACTGGAAGACGACGACACCAACGTGCGATGGAATACGTTG
CAGAAACTTCGGAAGATCGCTGCAGTGGAGACCTCCCATTTCCCAGTTCGCAACACGCGCCGCTTTCTGCAGTGTATTCGTCGACGGATTGTTGGCGAAG
GAGACCCTCACGTCGCTATCGAGGCATTGAGATTGCTAGCGGACGTGATGCTCTCGCTCGGAGACAGCGTGGACCAAATCCTGTCGTCTATTTTACCCCA
TTTGATCCCGATCCTACCCCAGAAACGTAGAAATCGTGAGCAGGATGATGATAGTGAAGACGAATTGGAGACATTGCACGAAGAAATGTTTCAGGTCTTT
CGAAAGTACACAAACGTCTCGAACGACCTGCAAGCAGTTGCCGATCTGCTCGTCAACATCGGTCTCGGGAGCGGTCACGGATCGGTGCGAGAAGCTTCTC
TCATTGCGCTGATGCGACTGCTAGATGAACGATTCCAGAAGCACGCGGTGACAGCTCGCGGGGAATCTACGAAGGCAGCTATTGGTCGTGGGGACAAGGC
GCTTATTGTCGCTCTTGTGCAAGCGATAATTCCATCACTAGAGGACTCGAACGAGAAAGTGGTCGTAGCTGCAGAGGAGGCGATCGCCAAGCTCCAGTCG
TACTGGGGGAGTCGCTTTTCCACAGATGTCATGAAGTTTTTGAGCAGTGAGGACAAGCAGACACTTCATGAGCATCGCGAGCCAATTGCAGACTTCGTGC
AGGCTTGTACATCATCTGCAACGCCTCCTCCTTCGCCACCACAGTCGTCAAGGCCGTCTTCAGCAGCATCTTCCAGTGATATGCTCGAGCAACTCGAAAG
CGACAAATCATCTACCTCTTCGCGGCTTTCTCCTTCGAAGGTACACCCGCTGAACATGACAGATCAGCTCCACTTCGGCTTCTTGAACGCAGATATCGTG
ACGGCGCTAACTACCAACACCACCAATTCAAATGCAGATTGGAAGAAGCGGGCAGCAGCAGTGGAGAAACTGTACGCAGCCTGCAAGCAAGTCGATGCAG
GTGTACTACGCGGACTTAACGCGGAGGAACGACTGAGGCGGATGAACGAACTGGAGAATCTGTTTCACATTTTGGTTCGTCTTACACAGGATGTAGACGT
TCATCTCGTGAAACGATCACTTCAAATCACCCAGATATTGTTCCGCAAGCTGGCCCCCCCACGGCAACTTGATAACGATAGCACGCAGAATGAAAACGAC
TTCGATATCGGCGAATGCAACGACCACGAGGCATCCAACAAAGGGCAAAAGGATGCCGCGTATTACATGACACAGATGCTAGTCCCAATGGTGGAGACAT
CGGCAAATTTTGCCGGAGAAGACGATGAGATGGAAGGTTTCGTGTACGCTCTACTGAGTCAGGTCTTTGAAAGTGGATGCGTACGTGTGAGCGGAATTGA
ACAAGTATTAGCTGCGACCTCGCTTCAGCACCGTCGATCGCGAGTGCGGGAGGAAGCTTTGAAAGTTTGGATGGTACTAATTCTCATCGCCGAGCGTGAA
CGCCTTCTCTCTGCAAAATACGTGCCTAGTGAAAATGCGGTGCAGACGTTGGGGCGTCTGCTGGGAGACACCAACGCGCTCGTACGTGATCTGGCTTTTG
AAACTGCGGCTGTATTGACAATGGTGTGCCGCTGTAATATTTATGAGCTACTTGAAACTTTTATCGAAGACGAGTATGTTGCCGAACGAGTGGATTGGGC
AGCATTGCGGGCCAGATTGCGACGAAAGTGCGTTCCCGAGCTTCGATCAAACGGTACGCTCCGACTAAAACCTGCCAAGGATGCTACTACAAGCAGATCG
TATCAAACAGCTTTGACCGTAGAGCAGTCTCTGGATGGTGTCTCCGAACTGAGAATGATGCTGGCAAATGACGAACCGAAGTCGTTTGAGAATCACCGCC
ACGATAATCTTTTGATTGAGCCAGTTAGACTGGCCAAGGGCAAGGTGATAACTGGAGGAAGTCTTAGCGATCGCTCCTACTTCAAGCAAGAGAAGTCTGC
AGTGGAAAGTGGCGCAAGCTGCCGAGCCACAATCAGCGATGAGGGAACTACGACGGAAGATATTAACGATAAGCTGGCAGCATTGAAAAAGAAAATGGAT
CAGCTTCGACAGCCCCGAGCCAAGCGTGTACGGCGTCCAAATAGCCAAGAAATCTTGAGTACCGAGCGAAACCTTGAAAACGCGATGGACCCCAACCAAC
AAACACTGCCACGCTCAAAGAGTTCACCCGAGCAACCCGCTTACAACCCTGCAGATGATGCTGACACGATGATTCATAGCAAGGATGCAAACTTTTATCC
ATCCCC