Description :
From Genome Similarity Track
Location :
contig_8:661613- 663032
Transcript NameFunction/comments
g1667.t1hypothetical protein

Sequence
1419 bases(100 bases per row)
ACGTACACAATTCCTGCCCTAGAAACCGTGGCGGGCGAAGCATTGCGCAGGTCTTCGACTTCAAAGAGAAGCTTGCAGTTGTCGGTCATAGGCAATCGAT
CGCCATTAGCCAGAGTCAGCAGCTTGTTGTCGTCCAGTACTGTGTTGAGGTTCTCAATCCAGACGGCATCAACTGGACCATCGCACACTAACCAGGCCAC
ATCCTTCCGTGATCGATCGTTGTACTTGGCCCAAATGGCCGCGAAAACGCCGTCGACCCATTCTCCTGTCAATCGGTCGGTCTCGCCGAAGAGTTCCTCT
GCTCGAACGGCTTTGGATTCAAACGCACTTGCCTATGCGGCGTTCGTGTATGAAACCCCAGCGCAGTCTGTAGTGTACGCAATATCTCGGACTTGCCTGA
CCCAGCAGGCCCCACAAGCGCAATTCCGTGACGCACGAGCTGCGTCTCGTACAATTGAGTCACCTTCGCGCTCCACGTAGCGGGTGGTGGCCACTCTGCG
TCTTTTGCAGATAATCTTCGACGGCACCAGCAATCTCATTGCTGCTGCTTTTCCCTCCACTGGAAGGAGCAGGCTCGACGCCGGGAAAATATCGCGGAGG
AGAGACAAAAAGATAGGCACATCAGCAGCCACGAGCTTCGAGAGGTTCATATCTCGCAGCGTGGTCATCATGAGCAATTCTTCACTTGCCAATAGATTAT
CGCGCTTGGTGGCACCGGCGGAACGCAGCACCGACAGAATATTTCGCAAACCAAAGTCGTAGTGGCGCTGTTTCGACAGTTGCCCTTCGCACACAGCGTA
CAGCGTCTTGAACTTGCGAGCAAGCTCCGCAAATGCGTCGTAGCCTACGGCACACAACCTCACTTTCATGATGATTTCACGGTCTGGAACCATCATGGCC
ACTCCTCGGAAGAGCGCCTTGAGATTTTCTGGGAGTTCCTGGCGTCCCTGGTAGCCCGGATTCATCGTGATGAAGTAAGCTGCATCTGTGTGCAACCCAA
TAGCTAGCGGGTCGCCTGGGAAGGTGAAGGTTGGAGCTTGCACCCGCTTAGCGTTTGTGATCGCAAGCACTTGCTGTGCTACCACAGAAAGCACTGGCAG
TTCAATGCGGTTGAACTCATCGAAGCAGCCCCAAAGTCCACCTTGGCAGAGGCCCTTGAAGATCTTCGCCATGTCCGAATAGCGTTGCTGGTCTGTACAA
TTCGTGACGATCACGTACACGCCAAGACTGCGTCCAAGGTCCTTGACAGTCTCGGTTTTACCAGTTCCTGCAGGACCAGCAGGCGCTCCACCCAGGTGCA
TGCCCAACGCTTGCGATAGTGTAATGTAGGCTCGGTCTGTCAGCGGGGTAATCACCAGTCGTTCCTTGCAGCCCAAGTACTCAAAAGCGTACTTGAAGTC
GACATCGCAGATCGAAATC