Description :
From Genome Similarity Track
Location :
Scaffold_1025:6616- 8540
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1025-snap-gene-0.6Protein kinase

Sequence
1924 bases(100 bases per row)
AAGAAAACGTGCAGGTGCGTGATCAGGTGCCTAAGCAGCGCCTGGGCGCGCGTCTGCAGCTTTGCGTCCACTGGATCGTCGAGATCAGCACCGTAGCGCC
CCCTGTTCTCCTCAGCGGTCTTTTCTCGAGTCAGCTTGTGTTGTTTGTTCAAGCTCCAGGCTCGATTCAAGAACGAGAACAGACCCGCGTGAAGATCGGC
ATTGTGCTGGCACGGAGCGGCTCGGCGCTCTTCTTCATCACCGTCATCGTCAGCACCAGCGACGCTCTCCAGACTTGTCGAGAGGGTCGATGCGTGGCGA
AAATGGGCGACAATGTGCTTTTCCTGGCTCGGAGGTACGAATTCCTGGACGCAGAAGCTGCCACCAGCACCGTCGTTTGCCGGAAACTCGCGTGGAATCT
GAAGATCTGGAACGGGGGCATTCATCACGATCTCCCTCGCACACAATGTTCGCACCAGCGCATCTAAGCTCGTCTCTGTTAGGTGCACCGGTGCGTCGCG
GACCTGGACTGCGATGACTTCGCTTTGCTTTGCCTTCGCCAAGTCCTAGGTACCAAGAGAGAGAGACACACACAGCATCATGAGGATAACGAAGCTAAAT
CCATTAAGGAGGATAGTGTTCACTGTACGAGACCTGCAACTGGGCTTCGAGTCGCAGGACATTGGTCTCAAGGAAATCGCGTCGAGCGACCTGGCACTCG
GTCTGGTTCTTATGACTCGCGTCCGTGAAGAGCCAGGCTTCAAACACGCCTTCGCTGTCAAAGAGCGCGGTCTCTGGGATAGCAACCTGGCGCAGGCCCT
TCAAGTGGCTGAAGAGCCAGTACGATGCAGCATGGTGACCCAAGAGCTCCACGTCGTCTGCCATGTCTTCGGGTGCTCTTGCCTCAGTGATTTGCGCCAG
CGCAATCACAGAACAGCTCAGCATTCATCACTCGTGCATGCTATTGATGGCTATTTATACGAAAGCAGCAATAGCTCAGATAAGAAGTGTGTACTCGCAT
TAAGCCATTGACACGCTCTTTGACGTGCAGCCTGCCAGCACACAATCCTCGCCCTCGCTGTGAATCCAGGCTGAATTGGTTATCTGGTGCGGATATTGGA
GTCTCAGCATCCACACCAAACAGAAGAAGTCTGCGAAGCCCAGGTTCGAAAATCTCCCAAGCTCCGCGGCTCTGATTCCGCTTGTCATCCGTTTGACTTC
GCTTGCGTTCTGGGAGGTAGGAGTCGAGGGTTCAGCTCGTCCATGTAGAACCCTCGGTCAACTCTTGCACATGTATGACGAGATGACTTTCGATGTGAGC
GCGAGTACGATCTGCATCGCGTTCGGCCGCTTCGCCGGGTCCGCAGCAACACACGAGGTGGCGAGGCGCTCGAGCGCGACGGGGCAGTCGCCTCGGAACC
GTGGCTTGAGCCGGCCTTTCGCGACCAGGTTGATCAGCTGCATGTTGGTGAGCTGCTGCTTGCTCACTTCTTCGTTGAGCGCGTACGGCGGCAAGCATGT
GTCGAGCTCCGAGAGCACGATGCCGTAGGAGAAGATGTCGGCCTTCTCCGTATACGCCTCACCGCGCAGGATTTCGGGCGCGGTCCAGAGCAGTGTGCCG
ATACCGCAAGTCATCGTCTCTTCAAAGGATCGTGTCCGACTGAGCCCAAAGTCGCTCAGCTTGGCCTGGAGGTTGTCGTTTAGCAGCACGTTGAAGGACT
TGAGGTCACGGTGGATGATCAGCGGCTCGAGAGAGTGCAGGTACACGAGCGCGTTCGCAATGTCGATCGCGATCGAGAGTTTCTCCTGGTTCCAGGTCAT
GCGGCCACTGAGCGTCGAGTTGATGAGGTCCGAAAGATCGCCCTTGCCCATGAATTCCGAGACTGAACAGAGATCCGAGAGTCCCTTCCAGGAGAAGCCG
ACGAATTTGACAATGTTTAAGTGC