Description :
From Genome Similarity Track
Location :
Scaffold_185:6616- 8122
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_185-snap-gene-0.12Secreted protein
Pytar_ATCC12531maker-par_contig_185-fgenesh-gene-0.6Sphingomyelinase C

Sequence
1506 bases(100 bases per row)
CGGCGGACCGCCAGGAACAAGTCCAGATCGAGATCGACACGACCGACGTCACGGTCGAGGACGGCATGCGCTTCTTCCTTACGAACCGTACGTGCACATA
GGCGAGCGAGCCGCGAAGCGTCAGTAGAGTCCATCCATCAATCAAAGACCCCCCAGCCGAAGAGAGAAGGCTGCGGGAGGTGTCCGTTTTATGTCAAAGT
AGACGATTCGATCGGTATTACATTCAGTTTTGAATCTACAAATACAGGGGTCTTGGTTTACAGTCTCTATGCTTTCCACATGTCGAACGTGAGCTCGCTA
ATGACGGGGAAATGGTCCGAGAGGTGGAACTGCGGGTGCTTTTTCCAGACCCACGGCGTGGTCGCAAAGATGGGCTGCACGTAGCTCACGGCGTGGGACG
GCTGGCGGTGCGACTTGGAGTAGAGCACGTAGTCGAGCAGCTCGAGACTGCCGTCGGAGCTCGGGCCGTCGCCCGCAAGCGGGTTGAGGCGACCGTCGAA
CGAATACTGCTGCATGCGCTTAAAGTCGAGCGCCGCCTTCGCGGGCGTCTTCGTCCTTGGCGCGGAATCGTGGGCGTCCAAGATTTCGAGCATTTCGTCG
TACTCGCCGTTCTCCTTGTTGAGCCACCTGTTGACGTTGAGATCGCCGACATACAGGACGCAGTCGACGCTCTCGTCAATGCCCATGGACTGCATGAGCT
CAGCAATGATCTCAAGCTGCTGCCGGCGTGCCGCGCGCGAGAGCGGGTCGTTCCAGGCCTGCAAATGGGTCGAAAACACGTGCACGAGCAGTCCGTCCTT
TAGGATCTTGCAGTACAGCACGCCCTTGTCGGCAAAGCGATCCGAGCCGGCGCTGACCTCGCGAAAGAGCTTGATCTTCACGCTCAAGATCGGGTACTTG
CTCGCGAGCACGACGCCGCCGTTCAATAGCTTGTCCAGGTACCGTCCGTCGGGCCCGCGGCGCTTGTGGCCGACCGTGGGCGAGTTAAAGTAGTACGCGC
CCGACTGCTTGAGCTTGTCGAGTAGCACACTGCGCGCGCGGTGGTCAAAGCACTCGGTGAATACCCAGAGATCGCAGGGCGGCAGCACGTCGGCAATGAG
CTTGGCGCGCGTGTTCTTTTTCGGCGACACGCTCGCAAACATGCTGATCTTGCGCGGCATCATCCACACATTGTACGTGCCGACGCGGAGCGTGACTTGG
CGCCGCTCCATGTGCGCGACGCGCCGCACCGATTCCTTGGCAATGGCCTGCAGGTTGCCGCTCTCCGGGATCGGAATTATGGTCGCGGGCGAGCACTGCG
TGCCTTCCGTGCTCATGTACTGCTGCGCGTCGCGGTAGTACTCGCGCGAGTGGAAGCCGCACGGACTGCCGTTGTAGTCGGCCACGAGCTGCATGGGCGC
ACCCCATCGCAGCAGCGTCGGCGGCTCCGCGGCATGGTGGCTGCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAAAG