Description :
From Genome Similarity Track
Location :
Scaffold_14:661543- 671061
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08563hypothetical protein
Phypa_INRA-310PPTG_08564radial spoke head 10 family protein
Phypa_INRA-310PPTG_08565hypothetical protein
Phypa_INRA-310PPTG_08566hypothetical protein

Sequence
9518 bases(100 bases per row)
AGTTCGAGCGTGACTACTACGCGCTTCTAGGGGTGGCACGCGATGCCTCGAGTGACGAGATTCGCAGCCATTTCTTGTCATTGTCGCGCGAGTTTCACCC
CGATCGTCGACGACAAGGAAATGCGGCGATCGTAGCCGCTGCCAACTCACAGTACGCGGTGCTGGACAGAGCATATAAAGTGCTGTGCGACCCGGTAAAG
CGCCGCGTGTACGACATCTACGGCGAGCAGGTTGGTGCAATATCGTGCTGTATTGCAAAGGGTTGGCTAAATTGATGGTCAATCTCCGTCCTGGCCTTCT
AAAATGATAATCCACCTGGAGCTCCTCTAAATTAATATTGAAGGGATGTGCTGACTGGAGGTGTTACCGCAGGGAGTGCACGCGCTGGAGCACGATGGCG
TCGCTCAGCAGCAGGTCGTTGGTGCCCACCTGGAGACATCGGACGAGGTGCAGCGATACGTGGAGAAGATCATGCGCCGCATGAACCAGCAGGCTCTAGA
AGCGCAGTTTTCGTCCTACAGCGAGATGTCCATGGGTGTAGACGCGTCGGATTTCGTGCAGGCGCCGATGCAAGGATTGCGTAGTCTGTTCCACAGCGGC
GCGAGATACGTGGACCGCACAGAGATGACGATCCACCAGCGCACAGTGTTCCCGTTGTCGCGCAGCACAGCGCTGACACTTGGAGGCTACATGTTTGACA
AGCAAGGAATGGGTATGGGCAGCTTCACTGCGGAGTTCGCGCACACGTCGTTAGATCCGAGTATCCCGTCGTTTACGCTCACGAGCCAGCTGGGTTGGGC
GCCCAAGCTCCACTGCCAGATCAGCCAGCCAGTGTCGCGCTACACGGTCTTCATGCTCATCCCAGAGCTCGATGATAACGGACTGGATATTTCTGTGGGA
GCAAACCAGCTCCTGTCGCCGCAGCTTCACGGTGCCATGATGTGGAGTACACGAGACGGTCTTTCTGGATCGCTAAGCCAGGACACCGGGACGTACAATG
CCGCGGCTGCCGTCGCTGTGAACGCTGCTGGCCCCAACTTGACGTTCCAGTTCCGTCGTGCTCTCCTGGCAGCTACGACAGCTAAATTGTCGCTACGGGC
AAGCCTTGCGACTGGCCTGTCGGTCGTGGCTGGAGCTAGTCGAGAGATTTCTAACCGTACCCGACTGGCGTTGGGTGTCTTACTTGCACGTGCGGGTGTG
ACGCTGCGTGTAGGCTTCACTCGTGGCAGTGTACGCTTTGTGATGCCCATTTTCCTGTCTCCGTTCTCCGCGCAGTCGGCCTGGTTTACCTTCTGTGCAG
CCACTTCACCATTTGTGGTGGCTGCGGTGGTCACGCAACTCATTAAGCCTGCGCAGGCGCGCCAGCGTCGTCTGGAACTGGAGCACCGACACGATATGCG
TGTGCAGTATCTCGCCACTGCGCGTCAGGGTGCGCTGGAGCAACAGAAATTGATGCGTCGGAGTGCAGAGGAGAAGATGGAGAAGGAACAACAGCGGGAG
GACGGCAAGGGACTGGTGATTTTACTAGGCCGATACGGCAAGAACCCGACGAGTCCTGACTCGCGTGAGGCCCGTGAAGATGATCTGGATGCAGCTCTCC
GCGCAATGCGGGACCGCGAACTTGGTGACGATGACAGCGGGGAGAACATCACACAGCAAGAAGCAGAGACTGAGCTACTGGAGCAGAAATGGGTCGATGT
GACGATTCCTTTGCAGTTCTTCGTCAAGGTACGAAGACCGAGTGATGGCTCTTAAGTTGCAATATTTTACCTGTTCTTGTTGTGGTATTCAGGACGGAAA
ACTCGCTCTTAATTCGTCGTCGAAGGCTGGATTACTGGGATTCTACAACCCCTGCATCAGCGAAGACCAAACAATCGCCGACGCACGGTCATCCAGCTCT
GCTGTTAAACCGCTGCTGTAAGTACCCTCTTTTAAGACTGCTAGTAGTCCGCTCCCGTCTCACATTCTGCTGTATGATTACAGATACATTCGCTATGCGT
ACGATGGTCAAGTGTTTGAAGCCACTTTCGACGATGACCAAGTGGTCAGTTTACCGTCGCGATACGCCCAGGTCATGGGTCCGGTCGGACGCGTGTACTA
GACTATAGAGGAACTAGGCGTCTAGGATATCTGTTTGGAATGTTTATACTACGCGATGACCTTCCACCTTCAGTGACTGCATGAATTGGTCCACCAGCAC
GTACAGAGGAAATTCTTGAGGTGTCTGACGTTTGTTTGCCACCATGTTCTGTTTCGCGAAAAGCACAGTAGCGATCGCGTCCAAGAACTCCGAGAATACC
AGCTTCGTGCTCATAAAGAATGCATCCGGCTCGCTAACCTGGTTGTCTTCCGAGCTTGATCCAGACGCGACGCTCCTAAGAAGCTCAGGTTTCAGTGGCG
GCGATGACGCTGCAAACGCTCTGTTTAGTGCTGAAAGTGCATCTCGGATCTGGAATTCCGACGTAAAGATCGGTGTATCGACTGGAGGCTCGTTACGAAG
CATGATGAGTACAGATCGAATGGATACCTCTGGTTCGCCTTTGTCTATCGGCTCCTGTTCGGATTCCTGCTCGGATATGTCTTCATCTAGCCGCAGTACT
GAAGTTGTTGTACAACTGTTGTATAGTATTTGAAGATGATCGTGGTGCTTGGTGAAAATGTTGTGAAGTTTCTTGCCCATCAGCTCTGCTCGTAGAAGTG
ATAGCCACGTTGAGGAACTTTGATTTAGTGCTTCTTGACGCTCACGCATCATTTGGTCGTACAGATCGGAGAAAACGTCCACAAGAAACACGGTACTGTC
GATACTCCCTGAGAGCTCGATCATGCCATCTGCCTCTGCAGTCGTAACCCAAGAGTACCCGATGCGAACTAGGAGCTCAACAAACTCTCTGAAGAGCAGC
AGTTCGTCCCAAGGTATGACTTCGAGTCGACTTGGATCTAGAGGGTGTTTGAGGTGGTTTTCAGCAGGTAAGTCTTCGAGAAAACACTCTGCGATGTTCA
TCGAAGACGCACAGGCAAGAGCACTCGCTCGCTGCGCCTTACGGATATCTTGCATGAACGTTTCGAGTTGTCCGCTGGTAAAGTAGAAGCCGCATTGGGA
AAGAAGCTGTCGACACTCGAAGAGTTCAAGAAGAATCCCTGTATCATCCGGATCATTAGAAGTGGAAGCTAATGAGCGACGAGATTCCTTAATACACTCG
CGATAGAGTGCACGCAGCTCCGTGTTAACGCGTAGTGCGGCGTGCTCGACAGCCTTTCGGGCCTTCTCGCGCCTTGGTATATCCGTAATCGGGAGTAAAT
CATTGATATACAGCATAATTCCAGCAGTGTTCGAGGAAGACGAAAGTGGTTGGGACGGTGACAGTGCTGATGTAGATTCGATAGAGGGTACAGAAGAAGA
AGATGTAGCCCCTGCGGTTGCTGCCGTCGCGTAGGAGCCTTCAATGCTTCGATCCTGTCGAAATAGTCCAACAAATACACGTCCGTCCTCGTAGAAGAAG
AGACCGTATCCATCTTTGACGTTCGATTTCCATTCACCCTCATACCGAGCGCCGTTGGCGTAGAAGAATACGCCACGTCCATGGCGTAGCCCCTCGTGGA
ACTCTCCCTCATACCAGTTCTTGTCGTGTGGGTTACTGGAGGCTGAAAGTCCATTCTTGCTCGATGTGTTAAGTGGACTCACAAGCCACACATGCCTCCC
AAAGCCTTGTTGGCAGTCGTTCTCCCACTCGCCGTCGTACCGCTCAAGTGGCGTAGCATCGCCGAGACTCGTCAGTTCATCTGTACCTCGCGAAGTCATC
CAAGTCATTACTCCTTGTCCACACTTGACGTCAGCTTTCCAGTTTCCCGCATACACACTTCCGTCCGCGTAGTGCATGTGTCCTCTACCTTCTCGCTTCC
CCTCAACGAATTGCCCCTCGTAACGAATATTACGTGCAGCATCGAACACCAACTCTCCGTAACCATGAGGCAGACCATTCTCCCATTCACCGTCATAACG
AGCATTACTCTGCGCAACGAATAGACCATCTCCACCCTTAGTCTCACTCAGACCTTCACCACCTTCACCTTGGTCTTCTTGAGAATGAAAGGCAAACAGA
AGCGGCTTCGGAGCCTCTTCCGCTTCCACCATCGCTTCCTGATTTGCTCCATTACCTTTCTCTTGCTTTAAGACAACACCGCGGTCTCCAGTAACGAAAA
CCCCGTGGCCATGTCGCTTGCCACACTTGACGTCTCCGACGTACGAACTGCCGTTGGGCCACCAGTAGGTTCCTCGTCCAGTGATCTCATTATGAGTAAA
CTCCCCTTCATACACCACACCACTAGTGTGCCACTCAATGCGTCCAATACCATGCATTCGACCATGAACAAAATCTCCATTGTACGTGAATCCCGTCTTG
AACTCCAGTCTTCCCTTACCATGATACACTGGTACATCGCACTCCGGAACATGCAGTGTCTCCCCATCGTACGATGTCACTACATTTGCCAGGACGCGAG
GGTCCAGCGGCGGTGACTTCGTCCACGTCGCTGCCGCCATTCTAGAGGTCCGTTACCGAAAAATGCACATGAACCGACACGCTTCAACTTCACAAGTGGC
TACAGTTAAGTGTTAATTAACCCGATTTCAGTTATGACATCACAAAAAACTCATTTAGGTCGCGAGCGTAAATGGCATCGACGTTCGCTCCTTCTTCGCC
GCCATCCATGCCGTTCCCTGCTGCGCTACCGTCCATTTCTAGCGATGATCCAACAAGAGATAAGCCTAGGCTGCATGTTTCTCCAACTCTACTCCATCGC
AAGCGAGTAGCACGTCGGAAAGCGCCAAAACACGCGGGCGTCTCCAGCAGCTCCGTTAAGCGGAGAAAATCATCTCCTGGGCCTCCTATCCACGCCACAA
GCCCTCAAGCCGTTGCAAAAGATGTCTATCCATCTCTAACTACAGATGCAACAGCGACAAAGCTGTCACCGACGCGGAACGGCCGACCCAAGCCAAATCT
TCAGATCGCGACGGATTTCTCGGCGAACTACTCGCCCACGAGTTTCTCGCCCGTAGCGCCGCTCGCCAGGAGTTCGCCATACCCTGCAACAGCCAGAGCA
ACAGATACAGAGCCCAAATTGAGCCAGGCACCGTCTCCAAGGGCCATGGTAGCTGGTGTTCCAGCGATGCCGCCGGCGCCTCATCCGTTCCGACTATCGG
ACTTTTTCTACAAAGAGATCTTTGGCGTCCACGATATTAAACAGAGCGACGGAGTTCACCAGGAACGTGTGCAAAACTTCTTCGTGGTGCCGTTAAATAC
GGAGCAATTATTCCTTTTCGGAGTGCTGTTAGCACTAGATAGCTTTCTCTACGTGTTCACGTATTTGCCTTTGAGAATTCTATTCGCGTGTGGATGCGCT
GTAACGTCGAGTTTCCATGCAAGAGTGTTCCGAAGAACGCACTTCTACGACTTAATGGTAGCAGTCATCATAGCAGTGGGCACAACGGTGTTGGGTTACG
TGGACATGTCGAGAGTCTACCATGCCATTCGAGGCCAGGCGATGATCAAGCTCTACGTGCTGTTTACGATGATCGAAATCTTCGATCGGCTATTCTCTTC
GCTTGGACAAGATGTACTGGACTCGCTGTATTATACTGCGAAGTACCACCCACGCCGAGTCACGCGCATGTTCCTGGACTTCGCGGTGGCGATCATCTAC
GTCGTGCTGCACTCACTTCTGCTGTTCGCGCAAGTAGTCACTTTGAATGTCGCCGTCAATTCGAGTAACACTTCGCTGCTCACGCTGCTGATTTCCAACA
ACTTCGCGGAGCTCAAAAGCTCAGTTTTCAAGAAATTCGAGGAGCAGAATCTCTTCCAGATCAGCTGCAGCGATATCGTCGAGCGCTTTAAGCTTCTGAC
CATTATCGGACTTATCCTGCTACAGTCGTCAACGGGAGATGTTGCCTGGGGAACGGTACGCTTTATCTAGTATTTTCCTTGCGTAGTTGTGTTCTAACAG
TATTATATTTTTTATTCACAGGCAATGGTTTGGGTGGCCGAGATGCTGATTGACTGGCTTAAGCACGCCTTCATCACAAAGTTCAACCAGCTTCCACCGA
CGATGTACTCCAAGTTCATCACCATTCTTTGCCGCGATCTGACAGGCTGGAAGAGCGAGGATACGATTCTGGATCACACCCACCACGTGTCCAAGCGCTT
GGGGTTGATGTCGTTGCCCCTAGCTTGTGTCGTGTTGCGAATGGTGTCGAAGGCGTTGGTAGAAGCTCCAATTGAGTTCGCATCACCTGGAGGGGTACTG
GTTACGGTGGCTTTCTTCCTCTGTTTGGCAGCATTCAAGGCGCTGTTGAGCTTGGTATTGATGATCTACGCCTGCAAGTCCGGTAGATTGGACGATACTC
GCCCCAAGAGCCCACGCTCCGTCAGCCACCTAGAGTCCATCCACCGCTACAAGTATTGATGGCAAAACTACACGCCCATAGACGCTTGCATGTTCCTTCA
AAAGCTTCTTCGTTCATTGTTATGGTCATTTTTTTTTCTTCTTATCGCCTGTGTCGTAGCCCGGCAGCAGAGCGGCGGCTTACTTGTACAGCATACTGTC
GCTTCTCGCCTTCACGTCCACTCGGCCACCTTTACGTCGTCCTTGTTTCTTTGATACAAGTCCTAAACATGCATTTTCCTCTTTTTGTATCGTGTCTTAT
CTACAAACGCGCAAAACTTTTGGATCCTTGTTTCCTGCTTCCTTGTCACTAGTTTGCCTCCGTCATCATACCCACGCGTCCTTCCTGTTGCGCGTCCCAG
CAATTCTCAGGTCTCTCTTGCTCATACACCACACGCTCCATTCCCCTAACTGCTGGTTCATACTTTTCATTCCACCGTTGTACGCCGTCAGCCACTTGCG
TGACAAATAATCTCTCCTTACGCACGACTCGTTGCGTTCATGCCCATGCCGCCCACATCGTTCAGCATCATCATACTGCCGTCATTGCCGTGCATCGGCG
GCATGCGGTTGTCACGACTGCCTCCTTGAAAGCCCATGCGTCCACCCTGCATTGCGTACATCTGGTTGGGCTGCAGATGCTGTTGAGGCATGTAGTTGCC
GCCCATAGTCGACGCGGGCAAGTGGCCCATCATCATCGTATTGCCATTATCGAACAAGTTGTCGGCAGTCGGCGACATGCCCATATCCATACTGATGTCC
ATATTCGGGAAGCGCTTGAGGATACGCGCCGTGATACGACGACCTCCCGAAGTGTTCTTCATAGCCGCCAGATGAGGACGAATGGCCTTCACCAGCAACA
GACACTGCTCCTCAGCACACACGCACAACGCACGCTGCACCACGTAGTTGGCGAACTGATCCTGCAGCATCTTGTTCATCTTGGGACAGTTCGTGATCTC
CGCAATGTACTTTTGACGCACGCGTTCGGGGGCCTTCTCGAGGCACTTTTCGATCACATTCGAGCTGAATTTCTGCACTGACAGCTCGTAGATGTGGCCC
AATGGCTTCATAATGACACCGAAGGCCTCTTCAGCCGTACACGAATCCAGCACGTACTGCACCACGTAGTTGCCGTATGGATCCTGCATCAGCTTCATGG
CCTGGCGCTCCACTTGCTCAATCACCTCCGCCTTCTGCGTCTTATTCGCCGCGTCCAGACAACGTTGTAGCACACAGCATCCGTGGCGATGCGTGCCCAC
AGTCGTGCACTCCTTACACACCGCATCGAACACAAACTGGTTGTATTCGGGCTTCATAAACTGCAGCGCGCGCTGGATCACGTGGTTGCCATTCGAGTCG
ATACACAGACGCACAGCGTCGTCCTTGAGCGCCTCCACAATCAGATCAGGCAGGCTGGTCGTCCGGCGTCCTCCTTCAGGGCGTTCCTCACGTACATAGC
CATAATCTTCCCCCTCTTCATCCTCATAGTCCTCTTCAATAACGTCCGGTGACGTTGCGCACACTTCCACCACCTTCTGCACCGATCTCGTTCCGTGCAG
GTTCAGCGCAGCAGCCACAAGATTCGAGCTCACACGACGGATAATCACAAGTCGTTGCTTCTCGTTCACACGTTCCAGAAGCTTCTGGAACAGGTAGTTC
CCAAACGGATCCACCATCATCTCTGCTAGATGCTCGAGTGATTCCTGATAGATCACCTCACACAGATCGGCACGATCTTCATAATCGAGCTGCTCCTGCA
GCAGTCGGCAGCCATTCTGGTCCTTCGACATAGCGAAGACGCGGTTCTGAATGTCCTCCACACTCAACGCAGCACTCAAACTCGACGGGTCATTAGCCGA
ACCGCCCATCATCGGCGCACTCATACTGCCGCCGTTCATCAAGCCCAAACTCATGCCGTTAGCACCAGCGTTTTCCGAGCGATACATCCGAGATTGGCGT
CCTCCAAACGATCCATGGCCGAGGTCATCACCGTGATGACGCTGCTGTTGCATCATGTGAGACGGAGGGGGCGACATCATCATCCTCTGCTGGTACATCA
TCGACGCATTCTGGCGAGCTGAGTGGCCCACATGCTCCGGAGTCTGAGCTCCACCCTGGTGCACGAACTTACACTTGCTGCCCATACGGCAATGGCCCTG
CAGGAAAAACTTGCACTGCTTCATGCCCATCTGCATGCCCATATTTTTGCGAGGCGAGTGAGGCGGAGACGCCTCGGGGAGCGGCGGCGTCATGCGCGAG
TACATGTTACGTCCATGAGCACGGCTATTCGTGTGGCCGCCACGCATTCCCATGGCCACTTGCTGCTGCGAAGCGTATCCCATCTGCGCGTGCGGGTGCC
TCATCGGACTCGAGCGTGGGTTCATGTACATGTTGTTACCCGCAACATCGTACATCCCAGCAGGCGGGTGTGGCCCCACAACCATCGGGTTCCACTGACC
CGAAGCCATTTGAGCTCGAGATGGCGCGTTACCATAGCCATACGACCCGTTAGCAGTCTGCGGCGACCTGTACTGCTGCTGACGATACTGCTGCTGTTCC
AGTGCGTATGATGGAGCCATTTGGTTGCCATAGTAGTCGTGCATCTGCTCTTGATACAAGGCATTATTGTCACCGTCCTGGCTACCCGACCACGAGTCTT
CAGACGACATGCGCGGACTCAGCGTGTACGCTCCGTTGTATGCAGCATTAGGCGCACTGCTGGTCCCTGGCACCGTACTTGAACGCGATAGAGACAGCGA
TGTTGGCATATGCGGCTGCTGCGCGTCACGGCCGCCTCGGAATCGTTCCTGCTGAGCAGCTTGCGGCTGACGATACCGACCAGCCAGTCCATACTCATTG
GGGGATTCCTGTACCGGATTGAGCTGGAACTGACCCGAAGCGTACGAATTGACGTTCCCAGCAGCGCTCGCACTAGTCGATACGCCATTGCTGACGTTCG
TAGCACGCTCGTTCGCTTGGAGACTCATCTGACGGTCATCAAGACTGAGTTTAAGGAAATCTCCACCCAACGCCTGGCTTGGCGACTGCGACAGAAACAT
CTCGATGCTGTTTTTGCG