Description :
From Genome Similarity Track
Location :
Scaffold_77:66152- 67667
Transcript NameFunction/comments
g11557.t1hypothetical protein

Sequence
1515 bases(100 bases per row)
CTATCCGAAATATGCGATTCATGCCGTCAGGAGAAGTTGATGCGCCTTCATATCTGTACCAACACGACGATGGGTCGACCAAAACTTACTTGCGTCCTGA
GTTCAAGCATTTGTTCGAGCATTCCGCCAGTTCAAGTTTCTTCGCTTATATACCCCTCTATTTTTGGCGCCCAGTTCTACATGAGACGAACAAGTACGCT
GTGGGGTACGACATACGCATGGCAACTCCTTTTACGCTAGACGAACTCATGATATTTCTTGGCATTCTCTTCTTCATGGCCGTGAACGATAAAGGTGAGT
ACGCGAATTACTGGGGGTTACAAGCCGAAGACTTAATTTTTGGTGGAGCTACTACATCGTTAGACAGCATCATGACCCTCCATCGGTTCAAGCTGCTACG
CCGGTGTCTGAGCTTCAATGCTACGCCTACCACACTCGCCCAAGATGGAGCAGCTCGTATCAGGCCACTCTTGAACTTGCTGAAGATTACTGGAGGTCAG
TATATTCACGTAGGGCAAAATGTTGCGCTAGATGAAGCCAGCGTCGCCTGCCGCTCTCGCCAAGGTCGTCACATGATCATGTACAATCCCATGAAACCAA
CAGGGAAGTACCATTTCAAGTTTTATATGGTGTGCTGTTCTACGACGTGGATCGCGTTAAACTACAAACTTCATTGCAAGCGAAGTGACGTGTTGAATCG
ACTGAATGGTGTAGTCGATCATTCGGAAGCACAAAGTATGAGTGATCAGCTGAAGAAATTGGAAAAAGCAAAAATCCGACAGCATGTGCTGGAGGTGACG
AGGCCGCTGTTTGGTACGAATCGTATTGTCAACATGGATAATTACTACACGTCGGTTCAGCTGCTGCAGAGTCTTCGCCTGAAGGGTCTCTATGGACGAG
GAACTGTCCGCTCAACTAGCAAACACTACCCTGTCCACAGTATTTTGCCTGAAAACGACTGCGTTCGTGGAGACTATCGCCAGGCGGTCTCACATGACCA
CAGCATGCTGGCAGCGTCGTGGTGTGACGGTAATGTCGTAAACATGCTGTCTAATGCTGACGCGTCCAATATTACTACTGTAACCCGCATGATCAGCAGT
GAAAAATTGTCATTTCCAGCGCCAGCGTGCGTCGCCCAATACAACGCCAACATGCAAGGTGTTGACAGGCTGGACGAAATTCGAGGACGATTTTCTATTG
CGGATGGCCATTCATATAAACGTTGGCACAAAAAGCTGGCCCTTGCTCTGATCGATCTGGCGAGAGCTAATGTGTATCTTGCACGGCGGTTGGTGAAGTC
AGAACCGACGAATCGCGATCCACATAGAAGCTTTGTAATGGAGCTAATAGGAGAACTTTTGAATGGGCAATGGAGGAACGCACCGAGCGACGGCCGCATG
TTATACAATGGAGAAATGCTTGACGACGAAGCTGCAGAGCAGGTTTCCACGCCTTCGTCTCAGCAGTGTGGAGGAAATGCTGCTGTCACTGCAATAACTG
CGTGCGCTTCAGTGT