Description :
From Genome Similarity Track
Location :
Scaffold_126:66139- 67712
Transcript NameFunction/comments
Sapdi_VS20SDRG_16406E1-like protein-activating enzyme G

Sequence
1573 bases(100 bases per row)
GGCCCTCGGCGTGAATGAGCGGGAAGATGCGCGCGAGGGCCTTGGCGGCGGTCGCGGCCTTGGGCTTGCCCACGTCGTTGAACTCAAACAAGGGCTGGCG
CACCGGGTTCGAGTGGCTCACCTAGTTGGAGCATATTGTCTGTTGTTGCAGCGAGAAGTAGAGCGTACGAGGCCATTGTCGACGAAGGTCAGGTGGCGGA
ACCCCCACGAAAGAAGGTTGCGGCCGACGTGACAGCCTAGCGTGCCGGCGCCGAGCAGGAGACACTTGGTCGACGCGAGCTTGTCGAGGTCGAGCGACGG
CAGCTGGCGCCAGCGCATGAGCTTGAGGTTGAGGTCTACGGACGTCTTGGCCAGCTGGAGCGGGTCCATGAGGCTGCCTAGTTGCATGCAGCGGGGTCCT
TGCTTGCCCTGGACGTTGAGCTCCCAGCCGACAACCTTGTTCATCTCGGCGTCTTCGTTGGCCCACGTGACGGTTGCGATGAACGAGGCTTTGGCCACGA
GCGACGCCGGCGCCGTTGTCAAGTGATGCAGTGGATCGCGAAAGAGCAAGATCGTCGCTGATGTCTACGGCCGCAGAATCATCATGTTGGAGATGTATCG
GCGGGTACTACGAACGTACGAGCGACGGGTAATGGCAGCGGATCCATGCGAGGTAGTTGCGCAGCGGCCAGCCCGGGTGCTGGGGCAGTGCGGACGGATC
GACGATGCCAAACAAAAGGTTGTCGGGCGCGGCCGGCGCCGATGCCAGCGACACCACCGTACCAGTCTCCTTGTCGAGCACAAACTGCATTGGGAAGTTG
GAGTGCGTGACGCCATCGGCTTCGGTGCACGGGCGCAGGTCGATGAGCTGCTGCATGATCGACGCATGCGCCAAGGGTGCCTCGAACGTCGTCAGCGGCT
GCCACGCCCTAGCCGTCACGCTGAGCTCCAGCGAATGGAGAGCAATGTGTCTTATGTACGTGACGCGGTACGGCGACGGAGGCACGAGCGCTGGAAAGGC
AAAACGGTACCAAAACGTGTGCGACTTGAGGTCGGCAAACGTCACCAGCACAAAGCACTGCATCTTTTCGGCGTCACCCGCAATCGACGACGCGACCTAG
CAGGAAGGGCCGTCGTTCCTAGGCTGCTGCAAGCAGTATGGTGAGCGGCGTACCGAGGCCCGCGCGTCGTCGAGCAGCGCCGCCTTGTCGATGGTCTTGA
AGGCGTCGAGCGTGTTGGTGTTGACGAGCACGCCTGGAAGGCGCCACTCGCGCTTGGCGCGGTCGGGCGACTGCGTCGGATCGTAGCCAAAGGCCGTGTC
GTCGACAATGAAGCGGGCGGGCACGTCGGCGTGCGGCGAGAGCTCAAAGAAGCCGGAAATGTCCTGGCAAGAGAGACTGGAGGCGAGCGCAGCAGAGGCA
GCGCGTACCTGGCGCGCGTCGCTGAGCTGGAACGTGTTGAGCTTGAGCTCTGCGAGCTTCTGGAAGAAGGACACGTGCGGTGAGCTCGTAAAGGGCTGGA
ACTGGAGCATGGGCGCAGCCATTGTCGCGAAGTTGTTTTTGCGATCTGCCAGCAGGCCGGATTCAATCGTCCT