Description :
From Genome Similarity Track
Location :
Scaffold_1301:661- 4852
Sequence
4191 bases(100 bases per row)
AAACACCTCAAGTGTTCAGCAGCTCGCACACGTGACAAGGCGACATATAGATGCTCAAATTTCCAATTCGGAGCTTTTGGAGTTCCTTCTAGCAGAAGTA
ACACGCGATTAAGGGTTAGACCTTGAGCCTTCCATACAGTCATCACAGTAGCCATTTCAACAGCATGCTGTTCATAGTGAAGCGTCGTTGATCGTCCAAC
TCCATCCAGTCGAATGTTGTACTTGGATTTGTTCGTTTTGATCAAACCAATCGGAAGGATCACCGATTTTTTCATTTGGATGGTAGGATTGTCGTTGCCA
ATCCATTCCGTCTCTAGATTCACATTGGGCGGCCATCCATCGGCGGATACCTCGTTTTGACTACTGTCAAGAAGCACAACATTGATGTAGTCTGGAGGAA
ACGGGATTTCAAGTATGGAACCTCGTGTATGGCGAAATTGCTCAATCATTTTGAATGCTTGGTTCGCTTTTGTTGGGTCATCCCATCCCAGTGAATGCAA
TTTGCAATTTGTTCCGTTACCAACGCCCCACCCAAGGTTACCGCTCGTATTCTCGAGGATTTGAGCTGCTGCACCTGGCACAAAGTAGCTGAACAAATTC
GGGTGCGTGCTCTCTTCGTATAGTAAATACTCAACTGCAGGCGATATTTCCTCTCTAATAGGCTTTCGCCATCGAATTGCTGTTACCCCTTTACGATCAG
CAATCAACGTCGCCACACATTGCGTCAAAATCGCCTTGTCAATATTGCTAGTTACCAAGATGCGCATATCGTCAAACCATTCACGATCATTCTTCAAATC
GCTCTCCGAAATCGGGTGCAACAAACAATCGATAACCCCATCCGATAGTGGTTGATACTGTTTCGTTTCTTTATTTGGCCAGCGTGAACCTCGTGGATAT
TGCTTGGGTAATGTTCGGCAAGACGCTAGATTTGCTTGATGTAGTTTACAGTCTGGTGCCCGGAGCTGCTGTCTCAAAGAAAACACTTTAAATAGTTGAA
ACAGTGCACGAGCTTTTACTATCTCGTCACTATTCGAGACTTGATCTGCATACATAGCTTTGCAGATGGGTGTACCTTGAACAACTGGCAATTGCAAGAA
GTCGCCTACCTGCAACCATGCCAATACCAAACTCTCAGCCAGTGACATCACAGTTGTCAGAGCGCCTAGCGAAACGTACAAACAGAATGGAAATGCCGCC
AAATGGACGATCGGGGTCATATATTGCTCTCAATCGTCGATCCATCAAGACTACCAGTTCGCTTCCAAGCATTGACACCTCATCACATACAATTAGACCG
ACACTTTCATGGAATATCTCTCTCATCGATGCCAACGCCTGTGGTGATATGTGGTGTGATCCTTTTCCTCGGACACGGAAAGCGGAGTGAAATGTTAATC
CGTTTGCTAGTTGGCTTGCACCAACTCCGGTAGGACACAAATTAATCACTGCTAAACTACGGAAATTCAACTCAGCTTCAATTCGTTTCAGTCCATACGA
CTTGCCTGTCCCACCACCACCGTGCATCATTGTCAACGTTTGATATTTGCGGCCATACTTGTCCAAACTTCCTACAATGTGATGCAGTACTTCGTATTGC
TCCTGGGTTACAAGCGTTGGTGAAATTCTAGGTACAACCGTGCTATCCCCAACGATCTGACAGCATTGACAATTTGGCCATGATTCGGTGTTTCCGATTG
ATTCGACGATCTTATCAACACGTCGTGGAAGAGTTTGAAACGCCCTTGCAACACTCGAAAATAAACCATCCGTGCCATCACACACATCAACGCCTGTTGA
TGCCCAACGCAACAGTTTCTCGTGTGTATAAATATATTCGTTTGAGTCGATTTGTCCACGAATTTGATCGTCCAAATCCTCAAGTCCAACGTCACCAATA
GATTTCCAGAAAGCATCGCGTAACGCGCAGCAAGTTGTAGATGATTCTACTTGACTTTTGGCAGCATTCTGCACAAGAGTAAGTAATTGCTCGCTATTAA
GAACTAAACGGTTGTCGCCTTCATCGCTGCAGTGATCACCATCGACTGCGGCATTTTCAGGTGTGCAGTGTTCGGCTACATTCGATTTTGCCGATGATTG
GTGCACGTCCTTCCAAAAGTCTGCGTTTCGATTACGCCAAGCGAGATTAATTCGCTCGTTTTCTGAACTGCCGTATCCTTTTGCCAGCAAGTTGTGGATG
CTCCGATATCGCTGTTTCTGAATGATTGAGGCATTATAGCTGTCCCAAGCTTTAAACAGCGAAGTTAGGCCTTGCACATTGAGCGAAAACGGAGGTAAAT
TAGTTTGAAAATCCCAAGGCACAAACGTTGACAGCAAATACGTCACTAGCTCATTCATTTTGTTTTCGCTCTTTAATGCTGCTCGATATGTCGGTGGCGG
AGCGCCACCTAGCATTGCTGTTCGAAACTTTGCTCTGATGTAACCTCGATACTCAGGATAAAGTGGGTGATCTCTACCTAGTTCAAATCCTTTTCGTCTT
TTTCGACCGGGTTTTTTAATTGCCTTAGTTGATTCAGATTCGCTATACGGTTTGATATCCACAATGCATTCGAATTCGAGTGGCGAATAATCCGCAAAAT
GTGGCCCTCGATTTGCGTATGACTCCGACTGTGTTACAAAAACGATATCGTTGCCGTGCTGGTATATTTTTGCTCCACCAGAGCCCGTTCGACACCCATT
GTCCTCCTCGCCGTTGTGCATCAGCGCAATGCATTGGTCCAATTCGTCATTGACATTGCCTTCCGAATCAGACCCATCGGACTGTTCAGACGTCTCGTTG
AAGTTCGTTCGTCTTGCGGTCACCGACGTTTGTCGCCGCGTGTCCTGCATTGCACACGCTTTCCCCTTCACATAACTCACAAAATCGCGAGGAAAAACGT
ACCAAAATACTTCTGACGACAAGAATGAACGATGCCCAAGTAACGCATACACCATTAGCGATAACGGCCATTCATCAGCTCCTCCAAATGCATTTACAGT
CCTAGTTGCAAGGTACATTCCTTGTCGCAGTGCAGTATTTCGGTCTTGGGATCTACTTCCATACTTGTTCATTTGATTCAGAGCAGCTAACATAATTCCT
ACTGTACTTTTCAAGCCTCCTGTCTCTTTAGTCATGTATTTATTTTGGTATTCCTCAACAATGTCCGCAGCGTCTTCGCATGAGAGAACACACGAATTGG
TATGGCTTTTAGTTAGTGCAGCTAGCGCCATGTTAGTTTCAACAAACATCTGATTGCTTTGCGATCGATGCATTTCCCACAATAGACAGCCATCCAGTTG
TCCTCGAAGTAGTTTGCCATTGTCGACATCATATCCTTCATCAATGTGGAGTATCACATCACTGCTTAGCGGAGCTGCTGTAAGGATTCCGCGACAACCA
TTCTCTAAATGACTTGTTTCTGCTTCTGTTACGAACAGAGGTTCAGTTGGCCCATGATGAATACCTGCTGGCCGGCTCAAACGGCACATGTATCGACCGC
GCTTCCCCTTTCGGCATGTGAACGAATGCTCGTGCATATTAGTTGACATCATAGCCTTCTGAGCTTCAACTTCGAACGCACGGATTCCTTGTCGAGCGTC
TGGGAGAGAAAATTGACATGCCCGTGGAAATACGCATTCATTTCGGGTTCTATACCCCGCATACCAGTCACATGTTTCCGGCCGTAAATTTGTGCAGCAT
ACAGCGTCTAGCCACTTCGCTGCGCGTTGGCGAAGTTCGGGATGCACCATCACACGAGTCAAAAGTTCAGGTGTCCATGATACCCCATACGCTTTTGCAT
GGACATGCAATCTTCCTGCTTGCTGCGGCTCAATGACAGCATTAAAAGCAGCAATTCGTGAGTATCCACCATGTTCTCGATCCAAATAGTTCCGCGATAT
TCGAGTCATTGAGCTTTCCAAACATCTCAACACATCACGTTGCATCACCAATAAGCGATTTTCGAAGCAGCGTGCAGACAGCGCTGGAAATCTGTTTGAA
ACTTCTAACCTGCAACGTGCGCTCTGTTGCAGATCCTCTGGTAAGTCCACCCATCTGCACCCTCTTCTTGTCAAGACGTTGTCCAACTCGTTCCATGCCT
TTTGCTTCCGTAGCTCCGCAATGCGCTGCAGTAACAAGTCGTCATGTTCAGGCGGCGCCATAGTCATCCAATGAAGCGCAGGGCCATAACG