Description :
From Genome Similarity Track
Location :
Scaffold_17:660871- 669013
Sequence
8142 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTTGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGG
GATGGAGGCTCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGATTAAGCCGTATGAAGGGAAGGAAGGCGAGAACC
TTTACTTCTGGGTCCGTGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCG
TGCTAAGAGTTGGGTGTACACTCGAGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCG
AGCTAAGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAAGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCC
TAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGAACTCAGCTGTTCCGGGTGCAGTCAAG
CACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAAGAAGAGTAGAGCCATCGCCAGGCGCGTACGCCCGGCCTCAGCGTGGCCTGGGTGATTCATTGGTC
GGCTCCCGGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAGCAGCGTGACATCCGCTGCTTCGGCTGTAGAAAGATGGGCCA
CTTCAAGCGTGACCGCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAAAAGCCAGGATCCCGGGGACAGGGG
AACGCAGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGA
GAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTATACGGATGTGTACGGGGATACGATCATCCCTTTAGGGTCTTGATTGAC
TCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCAAAGCTGTGAGAGAAAGCAAGGGCAACGGGACGGTGT
CAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAATAGTTCACTGT
TCTCGATATGGATCCATATCATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGC
CCTGCGCAGTCCGACAGAGCATTGGTGAGTTATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGAGCTGCCAGGGTACCAAAGCATCCGGCAGAT
GCTTGGGAGTCGTCGACGTATATGACGACTCCGGGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGTCGGCCAAGTGGGTAACTTAGGTCCACAGGC
GGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGCTCCACTCACGGTCGCCCAGACCATA
ACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACGCAGTACCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTT
CCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAATTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGA
GGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCACAGCTCTTCGTCACAGACGTCGTCGGCAAAGACGCCACCGCCGCCTC
AAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGACGAGTGTTATCACA
TCTTCGATGGCGAGACTGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGAAGAGATACTGCACCTCGAGTAAATGACGGC
TGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAAATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCACGAGGAGCGGAACTCCTCCTCTGTCTTG
GACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTAAGAACTCCAAGGATCCGGGGTATCGTTTGGTGACGG
AGTATGGTCCGGTGTATCGTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACATGCACCGACCCAGCTCCCACCGGATCAAGGTGTAGGGCACGAGAT
CAATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATACCTTCTTCGCCGCGAAAGCGAAG
GCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGCTCACGCTTATAACGAGC
TGAACAACGCAACGGTGCCGGACCAAACACCGATCCCACGAAAGGATGTGTTGCTGAACAACATGGCCGGGAGCGTGCTGTACAGTGCGCTGGATTTGGT
AGACGGATACTATTAAATCCTGATGCGAGCGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAG
GGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCC
ATAGCCGTGCCGAGGGAGGCAGGACGGCCATGGAGGTGCATCTAGGTCACCTTCGTCGAGTGTTGGACGTAATGCGAGGGAACAAGCTCTACGCCAACGT
CGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCA
GCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCTCTAAGC
TCTTGTCGAGTCCCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGTCAGTCTCCAAGAAACCCCTGT
CCTGGCCCTGCCGGTTGAGACGAAGCCGTTTAGCGTCGTCTGCGATGGCTCCGATTACGTTATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACAC
GAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAGCTACCGTGTTCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTAA
AGTTATGTGCTCACCTTCTGGGCTCTAGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAATTCGCCTCACCTCTCCCAAAGGAT
GGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGAC
TATGAGTTGGCCCACATCACGCGGGTGACAACGGATTTTTATGATCGGATGCGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCC
TTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGT
GGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGTGGCCACTTG
GGCCGCGAGAAGACCTTTTTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGC
GGGTCAAACCCGCGGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCC
CGCCGACGGACACGGCAACACCGGAATATTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAA
ACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGCTCACTGCCGCGTTTTGGAAAA
CGCTGCTCCCTTTACTGGGAGCTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACAC
TCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTC
ACGCCGCTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACCGACTCCTCTGTTCTAAGTGGGGGAGAGGCTCGGAAAG
CCCTTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATAGATACCAAGCTGAACATTTTCAGCAGGGTCCGCG
ATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGA
CACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCG
TCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGC
AGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTG
CGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCT
GAAGGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTC
CACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTA
CCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCG
AACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGAACGGAATGGAGAAGTCCACTTCCACGTGGAGC
GGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCT
CCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATG
AATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATGAAGTGGGCAAACCTCAC
ACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAG
AACATGTCCTCACAAGACCTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTAC
GACAAGTCGTGAAGTCCTTTAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACCAG
GGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGGACTTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGA
GGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAGCCCCCACGCACACGCTGGGCAGCTTGAAATTCCTCTTGCTGCT
GGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCCTCTTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCGAAGATACT
CTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCA
CGCGCAAGACCCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTTCTCATCGCCACCGGCTTTGGGATCGTCCTTAGCCTTGACGGCCGGACTCTCAGAG
CGCATAGAGGTCCTAGGACTGTGATCACCTTGATCACTAGCGAGAGACTGCACGCTGTCATCTTTGTGTTCACTGGGCACTGGGATGTGCCCTCCCACAG
AGTCCGCAGGAGCATCGTGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCATGTTCCACGAACCGAGGGTTCGGACGATTGTCTGA
AGATGAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTG
AGTGCAGAGCCTTTGCTGTGAGGCTTAGAGCTCTTGGCTTGCGCCCTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAG
GCATAATAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGTTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAA
GTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGG
TACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAG
GTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTAATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAG
TTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTACCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAAC
TTCCTCTAGCGTAAGGTGCTGTGTGACCCCGTCACAGACGAA