Description :
From Genome Similarity Track
Location :
Scaffold_27:66083- 67477
Sequence
1394 bases(100 bases per row)
CCACGACGCTGATGACTTCTGTATCGAGAACGGCATCCCTCCGACGACGTGGAAACAGTGGCGGCATAAGGGAACTGTGATTCTGGCCAGCACGCGCAAT
GGTCGGCACCAACCATGGGTGGACAGGGTAAGAAAGCACTCATACCCTTTGGGGAAGAGTTGCTGGAATATAGGCAGGGTCGTCGCAACGACGAGAAGTT
TCTTAGAGTGTTCCACCTGATGTTGTCGATTAAGCGCAATCGAAAGCAGTGGCTTCATTCTTACCTCGTCACGAAAATAAGTGTGGATCATGGCTACCGA
GCTTTGAACCATCTTCTCCGGTGGTTCAGCAAGCGGCATCGTAAACAAGGTCAAGCAGACTGTGCTTGACGAAGTGTAGATTGGATACGTAGCGCATTTT
TGGGGCAAGTATGGCCACTACGACAAGACCAACATACTGTATGCAGACGAGACCAGTGTCTCGTTGGCTGAAGTTGGCAAGTCCTCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN