Description :
From Genome Similarity Track
Location :
contig_24:660783- 688462
Transcript NameFunction/comments
g4659.t1hypothetical protein PHYSODRAFT_508840
g4660.t1hypothetical protein
g4661.t1Nuclear pore complex protein Nup93
g4662.t1hypothetical protein PHYSODRAFT_302410
g4663.t1hypothetical protein L914_07665
g4664.t1hypothetical protein
g4665.t1hypothetical protein PHMEG_000948
g4666.t1hypothetical protein F442_07885
g4667.t1hypothetical protein

Sequence
27679 bases(100 bases per row)
TGTGGGTGGAGCTGACCCGAGCCTTTGAGCTCGTGGAGCTGGATCCGAGTGTCAGGGCCGTCGTGGTCTCCGGGGAAGGCCGCGGCTTCACCAGCGGCAT
GGACCTGGACGTCTTCGCGCAGATGCAGAAGGTGGCGATGGACGAGTCCTGTGAAGGACGCAAGCGCGAGCGTCTGATGCGCGTCATCGACAAGTTCCAG
CAAATCATTTCGGCGCCGGAGAAGTGTCGGGTGCCGGTTATCGCGGCGGTGCATGGTCCCTGCATTGGCGCTGGCGTCGACTTCATCACGGCCTGTGACC
TGTGCTACTCAGATGTGAGCGCCATCTTCTCCGTGAAGGAAGTGGATCTGGCAATCATCGCTGATGTGGGCACGTTGCAGCGTCTTCCGAAGCTCGTAGG
TGAGCGCCAGGCTAAAGAACTAGCGTTCACGGGACGCAACTTCGGTGGCCTGGAGGCGGAGAAGCTTGGACTTGTGCTGAAGGCGCTGCCAGACCACGAG
GCGTTGATGAACCATGTTGGGGACGTGGCTAAATCTATTGCCAAGAAGAGTCCACTCACCATTCGTGGCATCAAGCAAACGATCCACTACCAACGGGACC
ACTCGACGGCGGACTCGCTGCAACAGATTCGTTACCACAACGCGGCGGTGCTGTACAGTGACGATTTGGTGCAGGCCGTGGGTGCGCTCATGAATGCGAC
CGAGCCCACGTTCCGGAGTGACTAGCGAGTAAAGTCAAGAAGTTGTTTTCAATTCCCTCAAGAAGAGCATGGGCACACAGCAACTGCTGCCGCCATTCAT
GTTCCCTTTTTTTGATTTTCTTGTTTCTTTTACGCTTCCCACCTCGCCACTAGCTACATGCGGATTGCCGCCACCACGCCGCCATTATCTGCGTTCTTCT
ATCGGTCTGGCCTGGCCTACCGCCTGAATACGCATGGCTCTCTCTCTCTCTCTCTCTCTCTCGCTACTCCTTCTTTCGAGCGGCGATAGCAGACAAAAAG
TCTCCTCGCCCAGGCATTCCTCCTCCTCGGCCGCGGCCACGAATAGCAGACAGCAAGTCACCTCCACCACCGCCATCACCGCCGCCACCTCCGCGTGCCT
TAATCGAAGAAAATAGGTCACCGCGTCCAGGTCCACCCGGCTTACCGCGACCGCGACCACGAATTGATGAAAGGAAGTCGGTGGGGGGTCCCGGAGGACC
ACCCTCGTCACCACCACGACCCTTAATCGCTGAAAACAGGTCGTTACGGCCACCAGCGCGACCACCACGACCCCTACCGCGTGCAGCCATCATTGGGTGC
GGTGCCCGGGCTGGGCCAGCTTCTTCGGCCGCCTCACTTTCAGCTGGTGCTGAAGCACTTTTGTTCTTATCCTTTGCTTCCTTCAGGATTTCCGATCGCG
TCTTCACGCGGCGGGTCATCGGCGGACCCTTATCCTTCAGCGAGTTCAGCGTGCTACGACTTTTTTCACCCAGGTCCTTCAGAAGGCCCCGAATGACGGG
AATTGCCGAGCGCAACCGCTTGTCACTTGCCTTCACCTCGTCCATACGCTCGTCCATGCCGTCAAAACAGTCACACACCGCATCACAATAGAGCAGGATC
AGGTTGCATTCGATCGACGAACGCGCATCCTTCGCATCCAAAGCTGCATTGCGCTTGCCAGACAGATTCATGCCCGACCGCTCGGCAAACTTCAAGCTTA
CCAAACGAACCTCGTTCACCAACTCTCCAAACTCTGCCAGTTCAACCTTAATTGTTGCAGCAGTCTCCGTATGCTCAAGCCGGCGTTTAAGCCTTGCCTG
GAACCAGAGTAGCTGCCGATTTTCGATCTGATCGAGCGATGTGTCAATCAATTCACACGCGCCATTTGCTTCAGCGACCAAACGCACGTTCTTGTAGTGC
TTCTTCAATGCGTCGGCACGGGAGTTAGCAAGTTTAGCTCGGGCCAATTCCTGCGCTTCTGCCAAAGCTCGCGCACCAGCATCATCGGATTGCCTTTTTG
AACCGTTGATTCCATGTACTCGTCACCATCGGGATAGCCAAGATCCTGGTCGTACGCCGGGGATCTGTTAGCTTTAATGGGACACTGCTTACCAATCATG
GGGCAGCCGATATCCGGGTCGTCGCGCGTAGCATACGGGTGATTATCATCAGGTCCGTACTGTTTTACGTGCTTGTTGTACGAGTTTACAACAGTCTTGA
ACGTCTCCTTGAGAGCCTTGAACCACTCATACTTCTTCTTCGTCATTTCTTCACCCTGCTGTCTTCCACGTATCCGCAATATCACGCAAGTGCATGTGCA
GGGCACGGCGCTCTGTCACCGTAAGACCCGTAACACGGAGATTCTCCAGCAACGAAGGATGGTTCTTCGCAATATCAGCTGGGTTCACACGAATCAATTC
CAGCACATTCGTTCGCTTGTACTTACGAGCAATATCACGTGGAGGGTCTTGCCTGTTGGTGACTTCACGGTCTGAAGGTCAGCCTCCGACATCTTCTTAA
CGTCGACCGGCATCATCCTACGAATTGCCTTCAAAGCCTTCACGTTAGCGTCGTAGTTCTCCTCTTCCCATTCGCGCTCCTTTCGCGCTTCTTCGGCTGC
GTACTCATCAGTCAGCATCAGTGCAGTGTTGTACTTCTCCATATCTTGCTCAAGGCGGTAGTATTCTTCGCGAAGCTGCTTCTGAATTGTAGGATCTGGG
TGGGTCACATCGGCAGATCCGATTTCTTGCATGCGCTTCGAGATCTCCTGCACCTTCGCCATAGCTTCTTCGTACGGGATATCTGCTGCCACAGCAATAC
CAGCTTGTTGCAACTGCTTCTCGAGTTTCAGCAGACGACGAAGCAGTTTCACTTGGTCACTCGAGATATCCAAATTGGCCAACATATCCTGCGCCTTGGG
CTCTTCTCTCTGTCGCGTGGAGCGACTTCGCTTAAGCTTTTCTACTTCTGCCTGCAAGGCACGAATCTTCTCGTCGTAAGAGTTGATACCGTCAAAGAAG
GCTTGGATTCCTTTCATCGACACCGTCCTCTTGCATTTTCTTTTTGACGTCATCGTTGGAATGTCCATCCTGAATCATGCGTCGGTAGGCACTGTAGATC
GACGGACCCTGTACGTCTGATTCTTGAATGCGGCGGTTGGCCTCAATCAAATTTTGTGCCTCTTCCTGCGCTCGTCGGGCTTCTGCCAGTTGCATTTCTG
CTTCCTCCTTAGCTCGGGCAGCTGCCATAGCCTTCTCCACAGCTGCCTTGCCTTCGCGTTGCTCTTCACGTGCTGCAGCCATAGCGGCTTCTGCTTTCTG
TCGAGACTGCTCCAGAAGCATGTGTGCTTCCTCCTGTGCACGAGCAGCATGGTGTGTAGCTTCATCAGCAGCCATCTGAGCCTCGGCCTTAATCTTGACC
ATTTCATCACGCTCGTTCATCATACCGTTGCTGTTCAAGTCATCACCAAGACGGCCACGTTCCTGATCCTCCTCGTACGCCTTCTGCTTGTTCACATATT
CTAGCGACAACGTCAGCACCGCTCCTGCAGACCGGCTACCAAGTGCCAGGGGGTACTTCTTAGTCGTCTTTTGCATGTTCGGTAGCGACTTCAAGGGAAT
TGTAAGCGTCGCAATAAGCTCCGTCGCGCGGAACAAATGCTCGTCAAAGATGCGAATCTCCACCACCATGTCATCCCTCGGCGCTTCGAATGAAGCTGAG
TTATCCTGCTTCCATACAGGTGAGCGCTGGTTTTTCACCACAGAAGTTTTGAAGGTCTCTGCGCCAACTGTGACTTCACAGATTGCGTTCACCGAGCTAC
CAGATTTCGTCAAGTTCGTCGCAGACAAAACACCAACGTGCACCACAGGGGTTGAAAACGCTTCGTAGTTGAACTGCGAAAGACGACCACCAGCGTTGCG
GTCCAAGAATGTTCCATCCATAGAAATGCTCTCGGTACGCTGGGTACGCAAAGCCTTGGCCTCCCTCAAGGACTCCCCAAGGTTCTGTGTACGGTTGACA
GTCTTTGAAGCATCGACAGCAAGCTTGACTGCATCCATCCAACCCTTTTTATCCGATTCAGAGGTGCATGCCATCACCATACGACGGTCGTCAACACGAA
GCTCCAACAAAAATTCTGCTGTCACGTTAGGAGACCGGCAAACGATATCTCCCGTGCCAGGCAGTGAGCGAACAGTGCAACGATGATTCAGAAAGCTCAT
CTCGCCGCGCGAAGTCGTAGAGCTTGGGCTCTTGAAATACTCCACCTTCGACACACTCAGCACGAAGTATCGCGACTTCCAATTGCGCATCACACGTCCC
TGCTTGTACATGCGTCCCTTTTTGATGGTTGCCGCTTGGTTATCCAAAATCAGTTGCGCGATCGACTGGTTATCATCACCGTCATTGCCCTCGTCCTTCA
CAATGCGAGGATTGTTCATCAGTTTCTGCTTCACGTGAGACGTGGACTCGCGAAGTCGAAACGACTCGGAGTGTCGAGAGTTCACACGCTGCACATCAGC
CAACTTGTCCTTAGGTACAAACTGCAGCGTCTTGGGGGCCGTCGCGTTACGAAGCACGTTCATGACCTCAAGGTACGGCATGCACAACACATCCGTCTCG
TTCACCTTATACACAATATCACCGATCGAGATCATGCCGCTCGTCTTGGCTTGACCCTTTAACGCACGGACAACAGCGCCGTCAATACCGTAGCGAACTG
CTTCCTCCAAGTTCAATCCCATCGGCCCGTTGTCGAACACCACAGCGTACGTCGTGAGCTGGGTATCCAGATCATTGTCCTTGTTGGCCTGGAACTTGGC
CCGCACAGCTTCCTGGCGTCGGCCTTCATCAATCTCAAAGGAAATGGCAAGTGGTCGAGGCATCTTTCGGATCAAGTCAATGGCGTCGGAGAATCCCATG
CCGTCCACATCCTGTCCGCCAATAGCCACGATCAGATCTCCAGCCTGCACCTTGTTCTCCAGCAACGGTTGTTGATGTTGTCGATGGCCAGGCCGTGGTT
GATCACGCCGTCCTTGGGGGCATGAGTTTCACGCCGAGTTTCTCCTTGGCAGGCAGCTCGATGACCACGACCTCGGCACCGAGTCATCTCCGCCGTTGTT
CCCATCGCTGCCAGAAGGCCCCGCAGCTTCTTGTTGTTGGTCTTCCTCCTCTGGACGCTCCGACCCGCAGGCCACACATGCCTCTTGGCCGTCCTCGTTG
GCCGTGAACTCGCACGCCGTGCAGGTCCACGCCATCTTGCGTAAAATTCGCGAGCTGACCTCTGTTAGAATATGACAACAGAGGAGGTTAGATATCGCTC
GTTAACCCTCTTCCTCGTTATAATAAGCTGGAGGGAGATCTATAATGGGAGGGGGCGTACTTATTAAGGCTGGTTCTTGGCTCTCTTGGCGCGCCAGATG
CTGGGATCGCGAGGCCACTACGCCGTTCGCCGCGTCGGAACTGGACGCGTGCGCCGCCTGCTGCTCCTCCGCGCACTCGCTCACGAGGACTGCGTGTCCT
CGAACTGCTTCTCTGGTCTGCGACCACCGCCGCGCGCCGCGTTTTCCCTTTTCGCGATCGACGATGGAAGGAGACCATCACTCCGCTAAAGAGCGGGCTA
GGGTCTTCAATAGTAAAACAAAGATACTGGTGGCGGCCTGGATCCAAACGGTGAACCCTGCTTTCGTCGTGAACCAGTCGAGTCAGTGGAGACTTGGCAT
ATACACCGCTATCGGCGTGTCGGCGGGTTTAGCTACATGTATCGGGCGCTATATAGTGCTGGGCGACATTGTCGAGGCGGGCCAAAGCGCCGTAGGTAAT
GGGCATCTTCCGCTCTCTCTGTTAGGGCTGTCAACGTTTGCGTAGACTGACAACTGACAGAAAACGTTTTGTGCAGTTGTCAGTTTAGCCTAAAGTGACA
CAACGGACGCTAAACTATTCAGCTATCACCAGCTGTTTCGCACTTACCTGACGATATACCTCTGGATGATATACTCAACATTATGCGAATAGACGAGAAC
ACGCCGAATTCTCTCTCTTAAACAAGCTGCGCCATGTCAGCTAGAAGAGCTCGTTGCGCGCATGGGGCTGTGCATCAATGCCATCTTCATCGTCACTAGC
GTGCACGATCGCTTTCATGACCTCCATCTTGAAAATGCTGGGGTCGGGATGGCGGGAGCTTCCCGCCGGAGGGAAAGACCTCACAACCGAGCAAGATCAG
AAATGTATGAAACAAAGCATTGGATAGTTTAGTGTCAGTCTGTGTCAGTTTTCGCGTGCAAAAACTAAACTGACAACGTTGTCAGTTTAGTTTCAGTTTG
TGTCAGTTTAGCGCTAAACGTTGACAGCCCTACTCCTGTACGGATCGGGTGGTGGTGTGCCCGCCACGCCGCGTTTTTGGTCCGGCCTTTGCGAGCGGCG
CTGTCGCAACGATCCAACGACTGGGGAATTGAAGTGGGACGCGAGGCTCGCGTACGAGGCTCGAGTCGAGCCTCGAGAGCCACTGGTGTGCAGGATAGGC
TGCTGCCGATGCCTCGCAGCAATGCCATCCCATCGTCGAGCAGCAACAATTGGGGTCTAGCGAGCGTAAAGAGCATTGCAGCTTTTTGCCGTGTTTAGTT
TGATGCCGTCAACTGCAGATGACCAAGCTTGGTGTACGAGGCGTAATTACGACACCATACACAGGTAGCTGTTGCTCTGAAGGTGTCCATGCAACACTGG
AGACCACTGAGGCGTGTCCTATCTTGTTCCGGTGCCAAGCGTATGGTAGATTAGGCCGTTCCGAGCAGTCGATTTGGCCAACAGCGTGAGAACCGACCTC
ACAGTCAGGTGCACTGTTAGACTACAACCAAATAGTCACTTGAGGCGATTACTGAGACGAACACGAAAGCGAATGAATACTATTTATTGAATAGGCGGAG
TACAGCCCCAAAGCAGATCAAGAAAGCAAACACAAGTTGGAGGCCTCTATGGAGGGAAGCCACGAGGAAAGGCAGCTAGTTACGTGTAGAAGGACCATTG
ACGGCAAGAGCGCTGTTGCCGGGGCTTGCCCTTCAACATGCGAACACAACCTATCTTATCGCATATATTTACCTACGTTCTAGCATGCGTCGCTTTCCGC
ACTTAGCGCCGCCCTCCATTGCTTTTGGGCGCGCGACATTAGCTCTGCCCCCTCGATCTCGCCATGGCCTCCAACGACGTGGACTTTCGGGCGCTGTACC
AGAGCTCGCTCAAGCTGACGACGTCCGTCGGGGAGCTGGGCATCCCTCGTCTGGAGAAGCGCCTGGAGCAGCTGGACGACGCGTCGCGCTCGCTCAATGG
CAGCCGAAAGCGGCCAGCGGCCGACAAGGCCAACTTCCTGCTGGCGGCCAAGGCATCGACGCCGAAAAGCTCAGCAAGGAGCTGCAGCACTTCGAATCGC
ACCCGAGTTCGAGCCCGAGACGCCGCTGGGTGAGACGGACCTGGAGGGGTATCTGGCCCACCACCACGAGATGATCGTGCTCACGGCCATCGAGGACGTC
AACCGCCGCACGGTGGAGGCCACCCACGACCGCATGAACCGCGCCATGATCGACGACTTCGAGGATGCCAAGCAGCAGCTGCTGAGGACCTGGGAGGTGC
CAAACAGCTCGGCATCCGCAACTACCGCGGTTGCTAGAGCAGGACGAAGCAGCGGGCAGCATCTTCGCTTCTGCAGCTCGCGAGAAGCGCCAGGCGCTCG
AGCCGGCGTCAGGACTCGGACTTAGTGGCGCGTCGTTTGCTGGCCAGCCCCGCTTCCAGTCCACGACGAGCTCGGCGCAGATGTCACAGCTGCAGGTGGA
GAACGCCATGAGCGAGGAGATGAAGCAGTACTACTCGGTGGTCAGGGAGCTCAACAGCAGCGCGTGCCCAACACGCGCAGTCAGTTTGAACTGGCGCGTT
ATTTCCAGCGGCTGTGCGCGTCAAACGTGTCGATCTCGGTGACGGGCTCCAAATGGGAGGCTGTGCTCAAGTGCTGGCAGCTCGTGAACGACATGCTGGT
GGGTGGAGATGCCACGAAGCCGAACGCGGCGAAGCTGGCTCAGCGCGAGTTTGCAGGTGTGAGAAACGGAAGCGATGAAACACAGCGGAAGCTGCTCCAG
CACCGCTTTGCTTTTGGCGCCCGTGTGTTCCTTGAGAACCAATTCCGTGCGTTCATGCAGGAAACCGTGCAGAAAAACAACCTTGCTACCGGCGGAATTC
CGGACCTAGTGTCCACAGTGCGTGCTTTGTGAAGCACCTGCACAGCTCGCGCTATGCTGCCAACGGAAGCGGCAGCAATACTGATGTGGACAATATTTGG
ACCATTGTGTACTACTGCCTCCGCTGCGGTGGCGACCAGGAGGCTGTCGATCTCGTGACTAGCCTGGCAAACGCCAGTGACTCGGATTCCCCGATTGACG
CCGACGTGCTTTGTGCGTTACGATACCGTGCACACCAGAAGAGTCTGTATGAGGATCGCAACGCCAACCCGTTGAACGCGTTCTCGAAGCAGTTCCCTGC
TGAATTCGACCATTTGGTCGACCGCTACCACCGCTTGATGAGTTCTTCGATTGACGCAGTCCCTGTTATAAACCCGTTCGAGCGCTGCGTTGTTAACCTG
CTGTGCTTTGGCAACGTCAACGCGAATGAGGCGCGTATCATGACAACTGTAGAGGACTACCTGTGGCAGCGCCTCTGCTTCATCCAGCGCGTGGCAACTA
CTAGCTCTTCGGACAGCACTTACACGATTGCCACATTGTCCAGGAGCATCCAGAAGTTTGGCCCCACGCACTTTGAAGGCGGGGTGCAGCCTGGAGGTGG
TAACTTCTCCGCGTTCCTGTACTTCGAAATCTTGCTTATCACGCAAGAGTACGAGAAGGCAATTAAATATCTGGCGTCTAAGGGCTTTCTACTGGAAGCA
GTGCACTTTGCGATCACACTGAACCACTATGGACTGTTGGAGTGCACATCATTCTCAATGGGAGAAGAAGACCAAACGACTGTCGATTTGGTGCGCCTCA
TTCGCCAATACATCCATGGCTTCCAGCGAGCCAACGCCGCTGAGGCAGCAGACTACGTGGCGTGCATCTCGGAGCTGACTGCGAAGAAGGAGTTACTTGC
GGAGCTGCTGCTCGACACGCGCAAGTTCGATGTGCTGGCTGGATTCACAAACAGCACAGACGGCTCGCGCACTCGTGGCTTGTACGACCACCTTCTGAAG
GATGAGCCTGAAGATGAGGTCAAGGAGCTGATTCTCTCGGCTGCGCGTAAGGCTGAGGCTCGTGGCCGCCCGCACGATGCGTTCGCTCTGTTGAAGAGCG
CCGGCGACATCGAAGGTGTCATCGCTCTGCTCAACTCGCAGCTCAGTTCGACTCTTTCGGCCCCACGACCAGAGCGTGAGGAGTGGTTCCGTGAGGCAAA
GGAGTTTGCCGAGAAATGGATGCGTTTCCCGTGGGTCCAGGCTATCGCTAACCGGCTTGCGCGCACGGCTGCCATTGCATTCCAGACACTTTTGAACATC
AGCATTTTCCTTGAGATGTTCGAGAAGCAGCAGTACGAGGACGCTATCACGTTTGTTGCTGAGCTGGAGGTTGTGCCTACACAGAACTCAAGCAATCTGG
CGCTCTGTGTGGATCGCTTCCTTGCCTTCGACGAGAGTGTCCGACAGAACTTCCACATATTGCTGCTCGGGTATATGGAGTGTCTCGTTCGCGATGCTGA
CCGCCTGAAGTCCCAGGTTTCAGGTGAGATACGGCGTGCTGGTGTCGGTGCTTTGCGTGAGAAGGCCGAGCTCCTCGTCACATTCGCAGGCATGATCAAG
TTCCGGCTCCCGTCGGGCACCAACGAGCGGCTGAACCGCATGGAGGCCATGATCTATTAGAATATGTGACCGCGCACAGGAAAATCATTTACGACCGTCG
ATGAGATGTACGAGAAGCAAACAACGAACACACATAGTTCGAAACGAAGGGTTTTCCGGGCTACAACTACACTGTCAGTCTCTCTTTTCGCTGGTCTACT
TGCTACTTCTTACGGCCAAAATAAATCTTGCATGCTTTGGCTTCATGCTTCGTCACGTCTTACAATGCTCTGCTGCCGGCAGCCAAGTATCATGGTTAAA
TTACCGCAGCGGCGCCTGGCGCTGGGAGAATAGCCGTGAGGCGTTCGACGAGAACTGGAACTTGCTCGGCGATGTCCGAGATAAGAACCTGGTCGACGCA
CTGGGCTGCATCAGGTGGTCACCTCGATTGGTGACGAACGCGAACGACTTGCGGGCGTCGAAAGCCGGAGCTGCCGCTGCGTTCGAGAAGTGGACGGATC
GGGCACTGCTGGATTTCCTTCAATGCGGGGCTTTCTCAGCACGAGCACCTTCTCCGCACTGCTCTCTCCTGTTCTTGCACGCTTGATGGCCGCCTTCCGA
GGCGTCCGAATGCGCGTAGGTCTCGACAGTTGGTTCACGTTAGCAGTAGAAGGTGCAGGCAGCGAGCTCGTGAACGCCGTCGTCGCGGACGAAGACGCTG
CAGACGAGAAGAAGGTGATGGGTCTGCCTGTTCCCTGCTGTGGTGCTGCCCAAGTCGAGGCTGCTGACGTCGTGGGGGCCGGCCATGTGAGGTCGCGCTC
TGCGCTGGGTGGCTCCTCGCTGGTGCCGAACCCCTGGAAGAAACGCTGGTGGGTTGACTCGTGCGACGCGCGCTCAATGCGCTGCCCAAATTGGTGCACC
GGATCTTGGCGGCGTGACCTGCGCCGCGGGCATGTCGAGTGCGCGTTTGTGCGGCGTTCTGGTGGCGCCTGGTCCGTACGCCACGCGGATGCACGCCCGC
ACGAGCCGCAACCGCTCCTCGCCGGCGGAGTCCATGGGAGAGAACATGAAGTCGTCGCTCTGCATGCTGCGGGTGTGGAGGGAGGGGTGAGCGGCAAGCC
GAGATAGGGGAAACGTTGAGAGAAGTGACACCAGCCCTACTTGACGTGGTCTTGGCAAATGGAGAAATGGTGGTGGATGGCCGCGTTTGAATTTCAAACG
TTTGAACTTTAATGTGAATGTTTGGGTAGATTATATGAAAGTTGGGCTCTAACACTTGTTTCTATTTTTACTGAATTTCTATGTTGTTTGTGGTGTGGGG
TACACAACGGCAAGTTGAAGTGAGCCAAACGTCTGCGACCCAGCGTTCATCTTTCTCGTCCTTGTTCCTCCAGTTGAGATTTCCCTGCCAAATAAATCAA
AGAGAGACTTGTCATGGTGAAGGCGGAGGAGGCGATTTCGGAGCTGCTGATGAAGTGTGACGAGAAGGGCATTCAGTCTCCGGAGGTTTGTGGTTTTGTT
GTCTAGTCCATTGTGTCACTGTCGCTAACCATTCAGTATCCCACCCTGTAGAACCCGTGGCAAGCGTTGCGCGAGGCGATCGCGGCGCTCCGGAACACCA
AGGACCAGGCACTGGGGTGCCTGCAAGTATCGAACGCTCTCGAGCACCTGGCGAACAAGTTTGGCACGGAGGATGGAGTAGCGCGGGAGGCAGCTGCAAT
GGCGCCTTCTCCTCGGGTTGTGCGCACGCAGAAGCGGACGCTCATGCAAGACATGCCCAAGCGCAACCGCCGCAACATGATTCTTGAGAGTGACAGCAGC
GACGAAAGTTCAAGCGGTCAGTCGGAACTCATGAACGCCATGAGCCCCGTCGCGAGCAGCAAGAAGAAGAAGTACGCGAAGAAGATCCGCCTGCAAGAGC
AAGTGGAGGCCAACCCCGCCGCGAGAAACGAGAATCAGCCGCTCGTGGACCAACTGGTGCAGTTGGGCGAGTACGAAATGCGCCACGGCAAGACTCAGCG
AGGGCTTGCGCGCTGCGCGCTGCTAAGGAAATCCGAGACAGCAGGATGGTAATTACAACGGGGGCTCAAGCGCGGCAGCTTGATCACGTGGGCCCGTCGG
TAGCCACAAAAATCGATCAGCTCCTGAATGAAGGGCTCGTGGCTGCACTGAGTGAGTACGAAGGTGACGCAGAGGCTATGCCCGTGGCGAAGTAAGTCAT
CCAAGCATGCATTTTTAAGGATATGAGTTAGGAGACAAAGACAAATGGTGGACATCAGTGGAATATAAGGCGTTTTACGATGCCCGTCCCAGTTGTTGCG
ACCAACTGTCTTTGCCCAGCAGAATCCAAGAGAGACCGACGATGAATCTTCGCCAAGCACAGCGCTCGCTCGCCGAGCTGATCTCCAAGTGCGAAGCCGC
GCATATTCAGCTACCGAAGGTTGCTTTGTATGACCTACCTGAACCGTTAGTTCTATAGTTCTATAGTAACGTCATTCGTTGCTAATCACAGGATTCCTTG
GAAGCGCGCTCTGAAGCTGTGGAAAGCATTATTCACTCGTTAAAGGACGGAAAGGTAATGAGTGAACTTCTTACAGGGACTCTGTCGCCACTTGTCAACC
ATTTCTTCCATGTACAGCCAGACTTGAAGGCTGCACAAGAAGAACTTCAGCAGAAATATGGCATCGAGCTGGTGTGGAAGCAGCACATGGAAAATGAAGA
AGCCAAGCGCCAACGTCGTCGCCAATCCCGCCAGAAAAAATGTGGCGGAGGAAAGACAGCCCCGAGTCCTTCGCAAGGGTCCATGAACCTCGGACTCCTC
CCAGAAATGCCCGCACGGTTGGAAGTGAAAGCTCCCACCGTGCTAAATCTCGCAGGTGGAGAGCCTTTACAGGGTACAATGAAAAACGTCCCCATAGGTG
GTGTGGTGACTCTGTCCAAGCGCCCGGCTGCTAGCCAAGAAACACCACACGTTGGGATGAAAATCGCCAAAAGGCGAAAAGCACACAGGGGTTGATTGTA
TCGACAGCTCCGAGCGATACGGAGGAAAAACCACCCCCGAGATCTGCAGCAGCACTAGGAAATATTCTCAGTGAGGATAACGATGACAATAACGAGAGCG
CATCGTCTGGAAATCCTGACCATGATATTGTTGACCTACTGGACCTGGAAGATTTGAACGAAGTTGAGAGAGGCGGTGGCATGAGCAGCGATGAAGAGTT
TGCTCTGTAAACTTTGTGACGGGTGCTCAGTCCATCAATTCGGGCTAATCGGAAATGGCACCGTCTTCTACTTCACCGGATTCCACCGACGAGGAAGATT
GGGCGAGGACTTGCCGGCGAAAGTTTGAGTGAGCTTTCATCTACGTACATGCACAAGGGAAAAGGTGCAAAGTGAGTTTTCGACAGCGTAAGAGCAACAT
TGAGATAATCCACATAACACCTTGACAAGTACTCACCAGTGTTGGAAGCTCTCCGGATTCTACCGAGTTGAGTAAGCTGCCATTGCCACCCATCATACTT
GAATTTGTGTCCTTCTGGTTACAATATTTCCTCTTGCATTCGCCAAAAATCTCGCCATCACTGAGGTCCAACGCTTCTTCACGCGAAAGCTCTCCCTCTG
ACAGCTCAGCACTGCAGATAGAATCTGGTACACTGCTACCAGAAACCGATAAGCGTCTTCGTTGCCGTTGCGGACGTCGACGCCGAAAGGATCTAGCGCG
AAGCTGGTGACGATCAATTTCTCGGTGTATGCTGGACTTGTGCTGATAGTCTGAGGTCGAGCTGAAGAGACTACTGATCACTGAAACACTTCTCGAAGCA
ATCTCCAAACTATTTTCACTACTCGCGATGTCGTTCACGTTCAGCACCTTTTCCGTGAGAGGCACTGGCTCTGTTGTTGGCAAAGGCAGTAGAATATCTC
TATCTCGTTTCCCAGCTTCGTGCTCGGGTTTGTGACCTTGCTCCCAGTTTTCACTCTCGGATATAGTACTTTTGCATTCGTCTTCCGAAGAAAGCAGATT
TTCACTGCCTAGCAAATCAATGCTCGTATTGCTTTGCTCGCGATGGATTGAAGGCCTTGGCTCTTGACTAGGTTTCATCGCTTCGTCACTAAATGGCTTC
ATGTATTGCTCGGCAAGTTTGCTTTGGTGAATACGCCTTTCCTGACGAAGACGCTGCAAAACCTCAATTGAAGTTACGGTACCGAATAATTCGTGTGAAT
CGTTACTGTCTCGCAGTGAAGGCCCAAGAGCCCTAATGAAATGTGTTCGAGAGAAACGCATTGGCTGGGAACTCGTAAGATCTGCTGGAGGAGAGACTGC
TGCATCTTCATGTTTTTCCTCAGGAATAACAGCAACTTCAGGTTGAAGGGCGAGTATGGACTCTTCCTCCACGCCAGAACTTGTGCCCCCGATTCAGTTG
CGACAGCTGAGATGTCGGTTGTATCCGTAGCTTCGCCTACCCATTTCATGGTTTGATCTTTTGGTTCTTCTGTGAGGTTCTCGATACTCATTGCCCCTGC
AGTTTCCAGAGGTGCTTGATAAAGGTTCATCTGTCTGTCTTTCCAAATCTGCTGCACTAAGCCACTCACTTGCTCTTCTGTAAGTATGTTCGCCCAGTTC
ACTAAATCATCGGAGATCGCGTCTTCAGCGGCAGAGTTGGTTTCGAGATCACCATACTGCGTTTGGCCATTGTAGTACGCGGCAGCTCTTCTTAAACCTG
TGACGTCCTCCTTATCTTCCTGGTTGAAGGTTCCAATGTTGCGAATTCTCTCTCTAAGCAACTCTTGGGTAATTTTGCAGACCAGCTGCTCGTCGACTGC
TTCTTTTCCAGCAAGTGATTCCAAGCTTCTCCGCACTACGGAAACAGCAGCTTTTCTGGCCTCCACGTTGACTGAATGCGGAATGTCTGTAAGTATCCTG
TTGACTAAGAATTCAGGTATTTCCTTCATCACTCTTTCCTCAAACGCTGCAATTCTCTCTTCAGGACGAACAGTATCAACTTCGTAAACTCGGACTTCTT
GATCTATCATCGGTGGTTGGGGCTCGCGTGCATGTCGCTTCAGCATCGAGGAGCTGTTTGGTTGTGAAAATATCGGCAAAAGTGTCGACGGCGCGGACAA
CACCGGGATCCTGGAGTGACTCTCCTTCTTCACTTTCGTTTGGACGGCAGTTCTACTTCGTTGCGCTTTTTGCTGCTGTTGTTGGTCATAGGCAGCGGTA
ACAAAGGCTACGAACTCCTTGTAGTTTATCACCTCTTTCATTGGCAAATGTTGGTTGGTACGGCTACGGACAGCATTTCCATCCGATGAAGAGTGGATGT
GGCGAAAGAAAGATATAATCTTGGTGGTCGGGACAGAAATCTGCAAACGATGGAGGGCCATGCACGTCTCGATACGATTCATGACCATGCCTCTTTATCG
GTATCCAAGTCGCCAAAGAGCCGGCGAGAACGTCAGCGTTCAAGCGCATATCTCCAGGATTCCCAAGACCCCCGGCAGAAAGAACTGGGCGGGCACCAAA
TGACGCAACCGATGGCATAGTACGAAATTCCGACAAAACTTGTCTGCCAATGGAAGATGACGGAGGATCGTCCGTGTGTACTCGACGAGGACTAATTTCT
TCGACCATCAACATGTCCCCAGCACCACTATCGTGACGAATACTTGCGGCTGTCTTCGTTTCTCTCTGATGCACGCTTTTCACTGGAGAGCTACAATTTT
GCCGAGAATCTTTCGGTTTTGCTTCGTCAAGCGGACTCAGTACTGCGTTCCCAGCCGGCTTAGCAAGACCCACCGGGCTTACAGTCTTGTCACCTCCTTT
CACATCTTCATCCAAGTCCAGATCATCGTGCGGCTCGTTAGGCAATAGCTTGGTCGAATTGGCACTACCCCTAAAAGGCGAATCTGTATCACCAACAGCC
CCAAACGCTGCTCTGGGCGCTACATTCTGCTTTGCGTTCTCTTTATCCTCACCAGCAACAGGACGGGGGTCGTTCCTACGTGCTTCATCACCTTCCTCTC
CTCAGCAATCTCCGGTTTCCCCCACAATCGTTTCTCGCTCTGATTTACTCTAGTAACTCCATTTCTCGTCAATCGCTCCAGTGGTGGCTGCACCCCAATT
TCCCCCCCACAGCAGTTCCACCATTCCTATTTGGCCCCCTCCCAACACCCCCGCTCTATCCTTTCGCTGCCGATACGGGAGCGCCGTCTCCTTCCTCTTC
TGGTTCCAGAACCTCTGCGCTGGAGGATATTGCTGCAGCTCTCGGTCCACGCGCGCGATGCGTCTCGCCACCTCCCACTCCACGCGGCGTTTGTATCGTC
GACTGACCTGCAGACTCGCGTTCCCTTCCAGAGCCACGAGCATTTGATCCGCCTCGCCCGTGGCCGACTGTTCGGCCTGCGAGTGCAATCCGCCGCCGCG
CCGTCTCCGGGGCGCGGCGCTCTTCATCACCAACGCATTGTCCGTCCAGAGCATCGGCAAACTACTGCGGAGACGCATCTGCAGCGCGCGGTTCCGGGCG
CTCACGTCGCTCAACAGCGCGTAGCTGACGTCGAGCGACCGATCCATGACTTGGCAGATGGCTGCGAAAGTTGAAGTGTCAACCGGTAGAGAACCGGTAA
TGTACCATAAAATAGGCACATTTGACGCGACCGTCGTCACCGAAAACGTCCTGCATTTCTCTGCGTTCTCGATCCCCAATCAACCATGCGATGCAGTGCA
TGTTTATCGCTGCAAACAAATTGCCCGCAACACACACGTGTCTGCAGACACCTCTTGTGAACTGGTGGCGCAGTGCCTTGCAGATTCCATTGCGACTTCG
TAGTCGCTGATTGGCTGACGTGTCTGTGTGGCACACATAGACTGTCCCATCTGCTCATCCCTGTTTGGCAGCCAGCGTTACCGGGGGCTTTCGCGCCGTC
AGTTGCGAACGTCGCTCGCTACAGCATCTCGGTCGCCATGTTGAGGACAGCACGCTGCCGCCTGCCGGTACGAGCGGCGTCCACTGTCCGCCACAACAGC
AGTACTAGCACTAGCAGCATCCGCCTCCCCCGCCTCTCGGACCTCGTGCTCATACGGCACGGAGAGAGCGAAGGCAACGTGGCCAGGCAGCGCTCGCTGG
CCGGAGACCACAGCCTCTTCGCGGGCGAGTTCAAGCACCGCCACAGCTCCAACTGGCGCCTCACGGACCGAGGCCGGCGGCAGGCGGCGGCTGCTGGTGA
TTGGCTTAAACGCAACAACCTGGCGCACTTCGACCGCTACCTCGTGTCCGAGTATCTGCGTGCCATGGAGACTGCTGGCCGCATGGGGCTGCCCGACGCG
CGCTGGTACGCGGAGATGCTCATCCGCGAGCGCGACTGGGGCGCTATGGACCTCATGAGTGAGCAGGAGCGCTTCGTCAAGATGCAGGACGAGCTCAAGC
GCCGAGAACTCAACCGCTTCTACTACGCACCGCCCGGAGGCGAGTCGCTGGCCGCGGTGGCCCAACGGGCGGACCGGCTGCTGGGTATATTGAACCACGA
GTGTCACGACAAACGAGCGATTTGTCGTGGCCCACGGAGAAGTGATCTGGGCCATGCGCACGCGGCTGGAGAGGATGTCCCAGGATACGTTCATTGAGTT
ACAGGAGTCGGGCGCATGGTAGACCAGATCCACAACGGCCACATCTTGCATTAAAGACCCGCAGACAGGAAAAATGGCTCCGTTCTTCACGCACGTGCGG
TCCGTGTGTCCGTGGAACGAGAAAGTCCCAAGGGATGGATGAAGATCGACCGACCTGTGTACGACAACGATTGCTACTGCTGAGCGTGTCCCACGTATGA
TCATCTCGGAGGAATATCTCGAGAAGACGTATAACGGTGCCAAGACGTTATCCGATGCAGATATGAACTCGGACGTATTGGCGCATTCGACGAGTTTGAG
CCAGGCGTCCTCGGCACCGAAGGAACCACCACGACGGCTGGTACTTCGTCCAAGAAGGAAGAGCGCCAAACGCCGCTTTTGATCCCTGGAAAGCCCATGC
TGAACCTGAAGAAGGTGGTCGTGGTGAAAAAGACGTCTCGCTTCCAGCACGAAGCTGAGTTGTACGGCAACACAGAGTAAGTTGACGTAGCCTGCTTCTG
TGTGTCTGTTTACGTTACTGACGCTTGCTGCTTCGCATGGTATTTTGATGTTCGGTATTCAGTGAAGCGCTGAGGAAGCAGATGTCGATGCGAGGCTTTG
TGCATGACCGTTTGAAGGCGAGTCACGAGCATCACGTCGAGGCTGTGGACGAAATCACCAGCAGGTACCTCTTGTTTTAATCTGCGTGCGCTCCCTGTGC
CCTGACGCCTGACTTGGTTTGGGCAATGATACAGCTTCAAGGAGCGCGACATCGAGGTGAAGGTCGTCTCAGCAAACCAGCTTACGCACGAAGCAGTGGA
GGGAACCGACATGATCTTTTCTGCGGGTGGTGATGGCACATTCTTAAAGACTGCAAGCTTCGTAAACACTCCGACCCTGTGGCCGGCTTGAATACAGACC
CCAAGCGGAGTGAGGGAAACCTGTGCTGCTACAAGGTGGATAATGTCACTCACCGATTTAGTACGGCACTGGACCGCCTACTGGAGGGCGACTTCAAGTG
GCGACTGCGCCAGCGTATTCGTGTCGGTATGGTCAACCAGGATGGCTACTGGTATGAGCTGCCTCGGTATGCGCTGAATGAAGTGTTCATCGCGGAAAGT
GATGCATCTCGCCCATCTCACTACAATATCGGTATCGATCAGCACCAGCGTGAATCCCACCGCAGCAGTGGCATTCTCATGTGCACAGGAACAGGTTCAA
GCGCGTGGTACTCGAGCGCGGTAAGTGAGGATGCCTTTCAATGGGGTTGGCTCCTAACTAACGAGCGTCTGTCTTTCAGTGCCAAGTCTATCGAGAGCAG
GTTGCAAACGTCCTTAGCGCGATGAACCACACGCACACGAATGAGACGGTGACGGAGCTGACAGAATCGTACGTTTTTTTCTCTGCTGCAGCTTCAGTGG
GACAACCAAGTGTTGGTGTGGCTAATAGGTTGTTGTTGTTGTTGTTGTGTTCCCGTGCTCGCAGTATAAACAAGCAGAATGTTTTTCCGGAAGACTCGCG
GGACATGGGCTACATCGTGCGCGAGCCGATTATTAATGCTACATTCGGTGATATCCGGTTTAGACGGTTAGTTCTCGTGCTTGGCAAACTTTCATGTGCA
AGCGTGCTTATGTTATTTTTTGCTGTTTGCAGAGGCAAAGCTCGCCGAGTTTCTATGCGATCCCTTGGGTGGGATATGAAGGTCAACATCGATGGCATCT
ACTCGGTGCCGCTAGATTACGGCGTCCAGGCGGTTATGAAGATCGTTGACGAGCCAAAGTATGTGCTGCGCACCGTGGACTTCTCCCCGCTACCAGGCTC
AGCGCCCAAGAAGAACATATTTTAGATTCAGCAGATACCAACCAGTTTTGGAAATGTCAATACTCATTCAATTACACGACGCCTTGGCAACCCGAACTTC
AATTTGGCAGACATTTTATTGTTGTTTGTAGGGGTCAAGCAACTAAACCTACCGGCGAGATCTGGAGCGAGAAGAGTGGCGGCGATGGTGTCGAGAAGAC
CTCCGAGACGATCGCGAACGTGAACGCGATCGTGACGACGATTCTGAACGTCGCCGGCTGCGATGGCTCCTCTCTCGCCCACGCGACGGCGATCGGCTGT
CGCTACGACTGCATCTACGACGTGAGGCGATCATGGTGTGCATGACGTGGCTCTCGTCGTGGACTTGGTGTGTAACCCTTTGACTCTTCCCGCCCTTGTG
CCGGTGAATAACGCCTTGAATGCGAGCGCTCCAGTTCCTTCGCATTGACTTCTTCTCGTGTAGTAGTGCGTGCCATTCGTGCTACGAGCTCCTCAAAGAC
CTGCTTCTGCTTCTGTGCAGACAGCAGTGCTGCAGGCTCACCGCCTGACGCTGCGGAGCTGTAAAATGCACGGACTAGTTGCTGAACCTCGTCGCTCTCC
CATTGCGTCGTCAGCTTATCCGGTGAAGCCAGCTTTTCCTCAAGAAACTTGGTGAGGCGTAGTTGCTCTCCGTCGCGCTTGAGTGCTTCGGACTTGTATT
CTGCAACCGCCTTGGCATAAATCTTTTCCTGGGCGGACAGTGTCAACAACGCAAGTGCATCGTCTTGAATCTGTTGTATCGCCCAGGTTCAACATTACCT
TCCAGCGTCGAAATAAACACGCTCACGTAGTGTTGGGCGCCCACGAGTCGAGCTGGAACTGCTCACGCAGCAACTGCGTGAAGAGATGTCTGGCCTGCTT
CAATTTGTTTTTCTTCTCTACCTTGAGATCTCTCGACGGTGCTCGATGAAGTGCTCAAAATCGCGCGTCGCTCGTCCATCGTCGGCACGCCCATAAAGCG
CGGGTCTCCAGCAATCTGCGGCAGTGCCACGGACCACTTGCAGAACGGCATGATGTTCTTGTCGCGCAGCATGGCACGAAACTGCTCGGTGCGTTTTTGC
TCACGATCCTTGCGCTCCTGCCCGCCTGCAACTCCTCTGCTGTCAATGGTTCTTCCTCTTCAACGTCTTCCTGAGTTGGTTTTCTCCTTTGCTTTTCCAT
CTCCTTTTGCTTCTTTTGCTTTTTGTGCTTCTTCTTCCTTTCTTGACCATCTTCTCCACCTTTGGCACTTGCTCACTAGCTATCGTTTCCACTATTTGCT
CCTTTTCGCGCTGCGCTGCAGCCTTCTCTGCCTCGACCTGTCCCCATTCACTGGGCCGCTCCCACGCCGACTCGCGTGTCTTCGAGTTGAAGTAATACAG
CGTCCCGTTTCCGGCGTCATGGGCCGTCCACGTGCTAGAGTGAGCAACAGCGTTCTGCACCATGAGCTTCATCATGAAGGCGGTCTCAAGCGGCACGAGG
TCCTCGGGCAGCTCCCACTGGGACACATCCGTCTTGCGGTCGTAGTAGAAGAGCCGTCCGTCGCCGTCGTCGTGCACGGACCAGTCGCCCACCACCTGCA
GCGCATTGAGCCAGTACAGCTTCTGCTCCGCCGTCATTTCGGCGTCGCTGCATGTAGCCGACGGCAGAGGCACCGAGAGTTCCTCGTCACCCATCGCGCC
AAAATGCACTTCGTGTGGTGCACACATCATATAGTGTGGTGCACCTGTTAAAAATGAGTCAGCTCCAGCCATTGCCGACCAGAATCAGACGTGCAGCTCA
CTTCGATGGCGGCTCCGGCTCCGGGGCGCGCGCCAACGGCGAAGCGCCGCTTTCTGACGGACGAGGAGTACGAGGAGAGCAGCTGCTGCTGGACCTGGAA
ACGGAGCTCCGGCAGGTGCAGGCGCTCAAGGCGCAGACGCAGGAGCGATTGCAGCAGCTGGCGCTGGACCAGAGGCAGCTGGAGCAGCAGCATCGGCGCC
TGCAGCGCCAAACTGACCGACATGACGCCGGCGCCGCCGCGCGCATGCTTCAACTGCAGGAAAAAGAGCGGGAGCGACTCACAGCAGCGGAGGTCCAGCG
CGAGCGCGAGGAAAAGGAAGCGACGGCCAAAGCGGAGGACACGGCGCGACGCCGAGAGAACGCGATCGAAACGCTGGAGGGCGACATGGAGGACCTGGAC
GCCTTTTTGGCGCAAGACGCCGCGAATTTCTGAAGTTGCGAGAATATTTATTGCCGACGAAATCAGTGGTGTTTGGAGAAGTTTCTGCGGCTGTTGTTGC
CTTTTCTCGCTTTGCATGTAGGCTTTGCGGCGGCAGCGGAGACCGCTGAAATCAGTGGTGGTCATGTCATCTGCTTGATAGTGCGATCTCTCGTGCCCCG
CTGGTCGACGAGTACAGTGAGTGAGTACGCTGTACTCTTGTGCAGCAGCATATGGGTCAGCGTCTTCAGCGCCATGGAACCCTTTGGCCATCGGCTCTGC
AGCGACGAGGGCACCGAGCCGCCATTTGGCCGCGTCTTATTCACTCCGGTTATCGACCACATCTGGTGGCCTCGCCGCTGTCTGAGTCGGGTCGGTGCTG
ACTGGCTTCAGTTAAGCGCCTCGGCGATCAGATGGCGGAGAAGATGTCAACCACTTCAACATGGGCCTCGGATCGCGTGCGCTGCTGCTACAGGGTGGTG
GCTGGTAGCGACGGTTCTTTGCCGCTGCTGCTCAAAGTACATGCATGTACCAGGCTGCAGGATGCGCTGTGAACGCCGCTTGGTGGCGAGCTTGTTACCA
GCCTCGGTGTCCGTCAACCGGATGAGGCCAGTTGCGGTGAGGAGTGATCTTCCTCGCTGCACTCGCCTCACCCAGCGCTAGGAAAGGCCCTTGCATCACA
CAGACACAAATGCGCTCTTCCTCTTTCGAATGGTGGCGAGTGCCGTGGCCGCACCAACCTGCATCGGAGTCAGTTCCGAGGGAATCCAAGTGAGACGACA
CATGATTGGCCGAAAATCCGTTCACGCGTCGCTACCACTGGCTAAAAAGAATTGCCTGAGTTCTGAGCGAGGCCAAACAAACCAAATCGAGCCCCCCTCG
AAACCCGCAAACACAACACAAAAAGCCCGAGGAAAGGTGCTCCTCGACACTTGGGAAGAATCGCAAAGCCAACCCGACCCCCTCCTCAAAAGCCGAGACC
ATCACTCCTGTCCGCACTAACACGCGATGGAGACTGCCCCCACCAAGGACATGAGCGACACGAGCAACCGCAAGCGCAAGATGACGGCCACCACGCCGCC
GCCGGGCCTCAAACGCGGCAGTAAGCTGTCGCGCCCAGCAGCGGCCGTAGGCGCCAGCATCTCGAACGGCGTGACGCCTCCCGTCGTGACCCCTCAGGGC
TCTATCCACACGTCGGAGCAGTTCATGAACCACCAGCGCGCCATGTTCAGCGCCCCCACGCCGCACGGGCCCGTGTCGCAGATGCCGCCCACGCCCGCCT
TCGTGAACCGCAACGGCTTAGCCACACGCCCGACGGCTTCTCATCCACACCCAGCGACGGCTTCCCGTCCAACTCGGCTCAGCCGACAGCGCTGGGACCT
CCACGCCCGCGGACGACAACCAGGCGGGCCCCCACTCGTCGCACGCGGCCACACCGTCGCCTGTACCCGCGCGGCGCCGCTCAACTTGCGCAACTTTGCC
AACTGGGAAGTCGGGACCCGCTACACGCTCGTGCGGCTGCTCGGCAAGGGATCTTATGGACAGGTACGGCCACGAGCTCAGTAGAAGAGGCGGTAGAGGA
GGTTCTGAGATCTGTTGTTCTTTTATGTGGTGGTCTATTATGTAGGTCGCTGAAGCGTTCGATACCGAGCGCCAAAGAAGGTGGCTATCAAGAAGATCAT
CAACGTCTTCGACCAGGAGATCGACTGCAAGCGGCTGTACCGTGAGATCTATATCTTGCGTCGCCTGAAGTGAGTAGCGGCTATTGCTAGGTTGTTATCG
TGGCGTTGCTGACTGACTTTTGTTGTTTATTGGTGTGGTAGCCACCCGCAAGTGATCAACCTGATCGATGTGATCCCACCAGAGAACTACGACACGTTTA
CGGACCTGTACTTGGTGTTCGACTTCGTGGACACGGACCTGCACAAACTCATCATGAGCCCGCAGTACTTGACTATTCGCCACATCCAGGTCTTCCTATA
CCAGCTTCTGTGCGGGCTGAAGTACGTCCACTCGGCCAACGTGATTCACCGTGATATGAAACCTGCCAACATCCTACTGAACGAAGACTGCACACTTATG
GTTCGTTCCTGCTACATTGCTTCTAAAATGGTTTAGTCGTGTTAATGTTTCCTGTTTGTTATGGCACGCTAGATCTGCGACTTTGGACTCTCTCGTGTGA
TGGAGAGCGATATGTCAATGGAGGAGCTGAGCAAGCACCTTTATTCACCCAAGGACTCCAAGTCGCCTACCACATCTGATGGAGGAACCACGTCGGCGCC
CTCTCCCGGAAGCGCGTCCTCGACGCCATCATCCTCTGGAGAATTCCCGAAGATGCGTCGCCAATTGACGAAGCACGTGGTCACGCGGTGGTACCGTGCG
CCGGAACTCATTCTCCTTCAAGATTACGACTTCTCAGTCGACATGTGGAGCGTCGGGTGCATTTTTGCAGAGCTGCTGAGCATGCAGGTCGAAAGCTGCC
CGCGGTACCAGGAGCGCGTGCCTCTCTTCCCTGGGCGCTCGTGCTTCCCGCTTAGCGCAGACCGACCCACTACTTACTCGGACAAATTAGACCAGCTCAA
CGTGATTTTCAACGTGATCGGCACGCCTGGTGAGGATGACATTGGCAGCTTGGGTGAGGTCAAGCAGTATTTGCGAAAACTGCCTAAGAAGGACCCCCGG
GACCTTCGTGAGGTATATACTGTCTTCTGTACGTGGATCTGAGTGGGAGCTGTACTGACTTGTTTGCTTGTGAACTTATTCAGATGTATCCTGGCGCCCC
AGCCGACTCGCTGGACTTGCTTAAGCACATGCTATCATTTAACCCAGAGTGCCGAATTTCGGTAAGCAAAAGTGTTGCAGTACCGCATCAAATCCTATCT
AACCACAATCTCTGTATCATCTAGGTCGACAAAGCGTTGGCACACCCGTTCCTAGATTCTGTACGGAGGTCTCAGTCGGAAACTGTAGAAGCTAACCCGT
TTGGCATGGAGTTTGAGAAACGTCCCCCTGAACAAGGAGGCCTTGAAAGGTTCGTGCTTGATATTAATTTGACGGCTAAAGTACATGATGCTGATTTGTG
TCTTTGTTTCATATGCGCAGCTCGTATCTTCGAGGAAATCAAATTGTTTGCGGACCGCAACAACCGGAGATGAATGAAGTCTCTGTGATCTGTTCGACCG
CAACGAGACAAGCGTCACCCAGCTCCGTCATCGACGCGCTCCACGTGAAGATAGATCCGGGCGAAGTGGTAAACGCCGGTGTTCACCATCGGTGAGTGTC
GGTTAGTTTGAGTGTACAGTGTGAGGAAAGGAAAGCAAGAACGAAATGGCGTGTGGAGTACAATGAAGCTACAAGTCAAATGGCGACCGTCTTTATGACA
GCAAGTTCCTCGAAGAGAAGAGGAGTTTTGTGCGAGCCAGCCCGGTAGTGGTTGTAGGGGCACACGTATTCGTTCTTGTGGCACATGCAGTATAAAGGCA
AGAGGCTGACGGAAGAACATACGGAAAGCCGAGAGTAAAAGTAAGTGGTTGCCCGTTTTCGCTTGCCTGGAGACTGCAACGAAGCCGAAGTAGCGGGCGT
GTTGCCTTGATATGCTTGAAGTGTCGTGTGTGTTTTCAATAGATAAAAAGAAAATTGATTTGGTGGAGGCGTTGGTGCCGTTGACATTCGTTACAACTTT
ATTTTTGCTTTCCTAGTCAGCGGAGTGTTGTTTCAAAACGGACATTGAAGTACTCCGCGATGGGATTGACGACAATCACTTGCTGAACAACAAACCGATG
CTAAACCCTCCACAGACCTGGTCGAAGTTCGCAGTGCTCACCTGACACCGCCAACTGCTTCGGTATTTGATCACCGCGTACGTTTACTTACTTATACATG
ATGGAGACCAGCGTGGATACTCTCGTGTACCAACTGGAAGACGACGACACCAACGTGCGATGGAATACGTTGCAGAAACTTCGGAAGATCGCTGCAGTGG
AGACCTCCCATTTCCCAGTTCGCAACACGCGCCGCTTTCTGCAGTGTATTCGTCGACGGATTGTTGGCGAAGGAGACCCTCACGTCGCTATCGAGGCATT
GAGATTGCTAGCGGACGTGATGCTCTCGCTCGGAGACAGCGTGGACCAAATCCTGTCGTCTATTTTACCCCATTTGATCCCGATCCTACCCCAGAAACGC
AGAAATCGTGAGCAGGATGATGATAGTGAAGACGAATTGGAGACATTGCACGAAGAAATGTTTCAGGTCTTTCGAAAGTACACAAACGTCTCGAACGACC
TGCAAGCAGTTGCCGATCTGCTCGTCAACATCGGTCTCGGGAGCGGTCACGGATCGGTGCGAGAAGCTTCTCTCATTGCGCTGATGCGACTGCTAGATGA
ACGATTCCAGAAGCACGCGGTGACAGCTCGCGGGGAATCTACGAAGGCAGCTATTGGTCGTGGGGACAAGGCGCTTATTGTCGCTCTTGTGCAAGCGATA
ATTCCATCACTAGAGGACTCGAACGAGAAAGTGGTCGTAGCTGCAGAGGAGGCGATCGCCAAGCTCCAGTCGTACTGGGGGAGTCGCTTTTCCACAGATG
TCATGAAGTTTTTGAGCAGTGAGGACAAGCAGACACTTCATGAGCATCGCGAGCCAATTGCAGACTTCGTGCAGGCTTGTACATCATCTGCAACGCCTCC
TTCTTCGCCACCACAGCCGTCAAGGCCGTCTTCAGCAGCATCTTCCAGTGATATGCTCGAGCAACTCGAAAGCGACAAATCATCTACCTCTTCGCGGCTT
TCTCCTTCGAAGGTACACCCGCTGAACATGACAGATCAGCTCCACTTCGGCTTCTTGAACGCAGATATCGTGACGGCGCTAACTACCAACACCACCAATT
CAAATGCAGATTGGAAGAAGCGGGCAGCAGCAGTGGAGAAACTGTACGCAGCCTGCAAGCAAGTCGATGCAGGTGTACTACGCGGACTTAACGCGGAGGA
ACGACTGAGGCGGATGAACGAACTGGAGAATCTGTTTCACATTTTGGTTCGTCTTACACAGGATGTAGACGTTCATCTCGTGAAACGATCACTTCAAATC
ACCCAGATATTGTTCCGCAAGCTGGCCCCCCACGGCAACTTGATAACGATAGCACGCAGAATGAAAACGACTTCGATATCGGCGAATGCAACGACCACGA
GGCATCCAACAAAGGGCAAAAGGATGCCGCGTATTACATGACACAGATGCTAGTCCCAATGGTGGAGACATCGGCAAATTTTGCCGGAGAAGACGATGAG
ATGGAAGGTTTCGTGTACGCTCTACTGAGTCAGGTCTTTGAAAGTGGATGCGTACGTGTGAGCGGAATTGAACAAGTATTAGCTGCGACCTCGCTTCGGC
ACTGTCGATCGCGAGTGCGGGAGGAAGCTTTGAAAGTTTGGATGGTACTAATTCTCATCGCCGAGCGTGAACGCCTTCTCTCTGCAAAATACGTGCCTAG
TGAAAATGCGGTGCAGACGTTGGGGCGTCTGCTGGGAGACACCAACGCGCTCGTACGTGATCTGGCTTTTGAAACTGCGGCTGTATTGACAATGGTGTGC
CGCTGTAATATTTATGAGCTACTTGAAGCCTTTATCGAAGACGAGTATGTTGCCGAACGAGTGGATTGGGCAGCATTGCGGGCCAGATTGCGACGAAAGT
GCGTTCCCGAGCTTCGATCAAACGGTACGCTCCGACTAAAACCTGCCAAGGATGCTACTACAAGCAGATCGTATCAAACAGCTTCGACCGTAGAGCAGTC
TCTGGATGGTGTCTCCGAACTGAGAATGATGCTGGCAAATGACGAACCGAAGTCGTTTGAGAATCACCGCCACGATAATCTTTTGATTGAGCCAGTTAGA
CTGGCCAAGGGCAAGGTGATAACTGGAGGAAGTCTTAGCGATCGCTCCTACTTCAAGCAAGAGAAGTCTGCAGAGGAAAGTGGCGCAAGCTGCCGAGCCA
CAATCAGCGATGAGGGAACTACGACGGAAGATATTAACGATAAGCTGGCAGCCTTGAAAAAGAAAATGGATCAGCTTCGACAGCCCCGAGCCAAGCGTGT
ACGGCGTCCAAATAGCCAAGAAATCTTGAGTACCGAGCGAAACCTTGAAAACGCGATGGACCCCAACCAACAAACACTGCCACGCTCAAAGAGTTCACCC
GAGCAACCCGCTTACAACCCTGCAGATGATGCTGACACGATGATTCATAGCAAGGATGCAAACTTTTATCCATCCCCAA