Description :
From Genome Similarity Track
Location :
Scaffold_39:66056- 67557
Sequence
1501 bases(100 bases per row)
CTCCGCTTGTTTGAGGCGCGAACGCCGCATATTACACTGCACATATCAATCCCGACCTGGAGATAGCGGACCTTTTCGGCTCGAAACGCAACGTGGCTGC
TGACGTGCATTCGCCCCCATTCGTAGCAATACCGAATCGGATTGGCAAGCATAGGCACGAGCTGCAAGGGTGAGCTTATGCCGCTACTCCGCTTGTTTGA
GGCGCGAACGCCGCATATTACACTGCACATATCAATCCCGACCTGGAGATAGCGGACATTTTTGTCTGGAAACGCAACGTGGCTGCTGACGTGCATTCGG
CCCCATTCGTAGCAAATACGAATCATATACACGAGCATAGGCACGAGCGGCAGAGGAGAGGTTTTGACGCTACTCCGCTCGTTCGATACTCGAAGACCGG
TGATTACACTGTACCTGTCAGGCCCGACCTGGTGGTAGCGGGCCTTTTCGTCTGGAAACGCAACCCGGCTGCTGACGTGCATTCGGCCCCATTCGTAGCA
AATACGAATCATATACACGAGCATAGGCACGAGGGGCAGAGGAGAGGTTTTGACGCTACTCCGCTCGTTCGATACTCGAAGACCGGTGATTACACTGTAC
CTGTCAGGCCCGACCTGGTGGTAGCGGGCCCTTTCGACTGGAAACGCAACCCGGCTGCTGACGTGGATTCGGCCCCATTCGTAGCAAATACGAATCATAT
ACACGAGCATAGGCACGAGCGGCAGGGGCGAGCTTTTGACGCTACTCTGCTTTTTTAAGGCGTGAAGGCCACATATTACACTGCACGTATCAACCCCGAC
CTGGAGATAGCGGACCTTTTCGGCTCGAAACGCAACGTGGCTGCTGACGTGCATTCGCCCCCATTCGTAGCAAAAACGAATCAGATAGGCAAGCATAGGC
ACGAGCGGCAGGGGCGAGCTTTTGACGCTACTCTGCTTTTTTGAGGCGTGAAGGCCGCATATTACACTGCACCTATCAACCCCGACCTGGAGATAGCGGA
CCTTTTCGGCTCGAAACGCAACGTGGCTGCTGACGTGCATTCGCCCCCATTCGTAGCAAAAACGAATCGGATAGGCAGGCATAGGCACGAGCGGCAAGGG
TGAGCTTATGCCGCTACTCCGCTTGTTTGAGGCGCGAACGCCGCATATTACACTGCACATATCAACCCCGACCTGGTGATAGCGGCCATTTTTGTCTGGA
AACGCAACGTGGCTGCTGACGTGGATTCGGCCCCATTCGTTTCAAAAACGAATCACATCGACGAGCATAGGCACGAGCAGCGGGGGCGAGCTTTGACGCT
ACTCCGCTCGTTCGATACTCGAAGACCGGTGCTTACACTGTACCTGTCAGCCCCGACCTCGTGATAGCGGACCTTTTCTTCTGGAAACGCAACCCGGCTG
CTGACGTGCATTCGGCCCCATTCGGAGCTGAAACGAATCATATACACGAGCATAGGCATGAGCGGAAGGGGCGAGCTTTTGACGCTACTCCGCTCGTTCG
A