Description :
From Genome Similarity Track
Location :
Scaffold_116:66047- 68417
Transcript NameFunction/comments
g11628.t1XP_002901377.1 conserved hypothetical protein [Phytophthora infestans T30-4
g11629.t1KUF87967.1 hypothetical protein AM588_10003737 [Phytophthora nicotianae

Sequence
2370 bases(100 bases per row)
GCCCAAGCGGTCAGCAGAGCATCGGCGTCGAGGGCTGGTCTGATGACGGTTGCGTTGCTAGCGGCAGCGTGTGCGTGGCCAACACCTACGGAAGCTGCCC
GAGCGGGGCCCACTGCGCGTGGCTCGACACTGGTGTGTACGGGTGCAAGGACGGCGCGGAGGAGTCGACACCGTGGGAAGGCTGTGCCAGCAATGAAGAC
ACGATTGGTGTTGTGGGCTGGGACTACGACGGCTGCATCGACTCGGACAACGTGTGCGTGGCCCAGGTGAGCAACGGTGACTGTCCGGCGGGCGCCTACT
GCTCGCTGCTCGACACTGGCGTGTACGGGTGTGTGGCGGAAGCGAAACACCACAAGAAGCACCACCACCACCACAAGAAACACCTCAACTGATGGAGGTG
GATGTTATGAAGTCGCGCCGGACAGGAAGCTCCAGCGTTTGTACTTAGTTGCGGCTCCGATGTTTGTATCTGTGCTTTGCTTCTTTTGCATGTTCTTCAC
TGCGAGGGCTGGTCTAGGTTGGTAGTTGAGCTGGTCACTGGTCACTAACAATGAATACACGTTCGTACCTGTATGCGATTGCTTTTGTTGTGAGCTCCGA
CAACCCGGCTTGGACCAGCCCAGTCAACCGTCCCGGCAACTCCTGCCGCTGGATAATACGCAGTGGAATGCAATCTACATAAGATTGTGTAGTCATATAA
CTCACTGCTAATACTGCTGCTGCTCTTACTTGACGTTGGAGTAGCTTTGGCGTGAGCCCACCGAGACCTTTTCGTCCAAGATCTCGTTGCCCAGGTGGTC
GAGCTCTGGGGACGAAGACATGCCCATGTTCATCTTCTTCATGACGATCACGAAGAAGACGAAGTTGATGACGCTGACAGCGCCCACCGTGAAGAACATG
TTCTCCAGGTGGTCCTCGTTCAGGTTGTCGGACGGCAGCGACTTGGAGAACATGATGGTAAAGACCGACGTGAGGATGCTTCCCATGGAGCTCATGAAGA
GGATCACAGCCTGCGCCATGGACTTCAGCGACATCGGGACACTCGAGTACACAAGGTCGTACGAGGTGACGTTGATCAGACACTCGGCCAGAGCAATGAA
GACGTAGTTGGGGATGGCGGCAGCCCACGAGATGTCGTTCATGGGCTGCGAGCTGCCACCGTCCAGGATCGGGTCTCCGTTCGCGTCCTCAAGAGCGCCG
GCGTTACGGCGAATGACCTCGAAGATGCCAGCCCAGAAGATGCCGACGATAGCGACAACGAGACCCACCGCGGACTTGCCGAACTGACTGGGGGACTTGC
CCACCCACTTGGTGTACGCAGGGTAAACGATGGAGTCCAGCACTGGGATGCAGATCACAATGACAATAGGGTCAAAGACGCCGAGCATGGCGCCAGGGAT
CTGAGAGCTGTCCGGGTCGCTGGTGTCGAGACGCAGGTCGCACTGCTGCGTGATGGACTGGAAGTTGGCATCGGTTTGGTCGTAGGCGCAGTTCCAGATA
ATGGTGAAGGCGGCGTAGGGCAGCACACGCACCAGCTTCTTGTAGCCTTCAACGCGCTCGTCGTCGAAAGTGCCGCCCATGCTGCTCTTGGACACGTCCA
GGAAAGACTGGTTCTGACCGGCGTAGACCCAGCCCACAATACCGGCAAGCACCAGCACTGCAGCCACGTACGACAGGATGTTGCCCACATCGCCCGTGTC
GACCGTAAAGGCCGAAATTACGTTGACGATGAGCGCAGCCAGGAAGCAGAAGGTGGCGGACACGAGGATGAATCCGTCGCGGGTCTGGTGCGCGTTCGCC
CAGCCCAGACGGCACATCATGGAGATGGAGCGGTCGTTGGGCGGCATGAAGACGTAGCGGGGGTACCCCACGCACAGCATCGCAATGGCGAACATCATCA
CCACCGCACAGATCATGTACGTCGCGAAGTAGCCGTACTCGGCTGGGATCTGAGCCGAGCCATCCACACACAGGATCGACAGGTAGCCGTACGAGAAGCC
GGCGCCCACGTTGATGCAGAAGTAAAAGTACGAGAAGTACGTCTCCTTCTGGTGCACTTCACTGGGGTCATACGGGTCGAACTGGTCGGCACCGAGTGTG
ATCACGTTGGACTTGATGCAGCCCGTGCCAATGCCAATACCAATGAACAGACCGATAACGAAGATGGGGTTCACTACAGCGGAGTTGGTCATGATGGTCG
GGTACGCGGCGATGGCCACCAAGAAGTCGCCCACGCAGTACCAGATCCCGAACGTGAGGATGGTGCGGAAGCGGCCCCACTTCTCGTCGGCCAGGTAGGC
TCCGAAGAGCGGCGTGAGGTAACAGATGGACGTCCACGTGCTCTTCAAGGCGCTGGCCGAGACGAGACTC