Description :
From Genome Similarity Track
Location :
Scaffold_60:66046- 67790
Transcript NameFunction/comments
Sapdi_VS20SDRG_13428RecA protein

Sequence
1744 bases(100 bases per row)
CGATGGTCCGCGCGATGTCTGGGTGCGCCTCAAGGAACTGCTTGGCCTACGTCATCAACCGCATAAGTCACAACCTTCTGCGCCACGACAAAGACCTTGC
TGCGTCCCTGCCCAATTGGCTCTAGTCGTACAGGTATATAAGCTTTCTAGTGCCCAAATATATCGAGTACCATCGTTGTAGGCATACCACGAACCGGACC
GCTTCATGGCGCCAACCTGCGTACCGAGGTCGAGCTAGAAGCATACATCGCGTCTTCGTGTGTATCTGTCCCTTGAGGAACGTACGATCTCGGACATGCG
GTCGATGCCCTTGCCGTAAATCACGTCAAAGTTGGCGACCTTGAAGGGCGGTGCGAGCTTGTTTTTGGCCACCTTGACGACGGTTTCGTTGCCAATGACC
TAATGATGTACCGACGCTTAGGACTACGTGGGGAGAGGCAACGTGTACGTTCTCGCCTTCCTTGATTTGCGTCTTGCGGCGAATATCGAGGCGAACTACG
GCCAAGGAAACTTGAGCTCAACGCAGTCCAAAATAGAGTACTCGATGCATAGTAGCGCAACGCCGTGCCGCCGGATGTGACTTCAGGAGACCCGAAAATG
ATGCCAACCTAAGCAAGTGAAGGCTGTTTCCAAAGAAAGGTTGCAACCTTTTGGCGGATCTGGTTGAGGAAAATGATCATGCAGTTCGACTTGGAGAGAG
ACCCAGTGAGCTTGCGCAACGCCTGTGCATGCCAATGAAACGGAGAACGCGGAGCTGGAATTTGCCATACCTGGCTCATGAGGCGTGCCTGCAGCGCGAT
CTGCTGGTCGCCCATCTCGCCCTCAAGTTCAGCGCGCGGTACTAGCGCGGCGACACTGTCAACGACGACCACGTCGATGGCTCCCGATCGAATCAGCGTG
TCAGCAATTTCGAGCGCTTGCTCTCCAGAGTCGGGCTGCGACACATAAAGCTCGTCAATGTTGACGCCTAATCAAGCGTGCGTGAAATGCAGCGATTGTT
GTTTCATTCTCTGACGTACCTAGAGCCTTGGCATAGTGGCCGTCGATTGCATGCTCGGCGTCGATGAAGGCGCAAGTTCCACCCTAAACAATCAATGCAC
CAGTCTGGCTCTCGTACAGTGGCAAGAGCATGGAATTACGTTCTTCTGGGCTTCGGCGATGCAGTGGAGGGCAAGCGTCGTTTTGCCCGAACTTTCGGGG
CCATACACCTCAATCACACGCCTATTTTATGCAGCAGTGAGCTCTCTCGTGGATACGGCGTCGCTTATGAGAGACCCGCGCGGCAGTCCGCCAATGCCGA
GTGCTACGTCCAACGAGAGCGAGCCCGTAGACACAACATCAATGTCGTGGGCAACACCGCTAGCCAAGGTTACGCATAGGGCGAACGAAGCCATGAGTAT
GCACTTACCTAGCGCCGAGTTGCATCACAGCGCCCTTGCCAAAGCTGCTCTCGATCTGGCGAATAGCCATCTGCAACGCTTGGCCCTTGTCGCCTGCAGA
AGCGACAGTGAGCACCTAGAGCTGACCTCCATGTACGCATGTACCAGAGGCGCTCGGCGAGGCCTTGGTCTTCTTGCAGCGAACGAGCGCGCGGGCCACG
ATGGCAGGCGCACGAGAAAACGACAGCATCTCGACGTTCCTTCCCGAAGCTTGGTTGTGATCGATTTCGGATACAATTCACTCTATTTCACACGCTTCAC
ACTATAAAAGTCAAGCTCGTTCGTCATCACTTTACAAGACGCTG