Description :
From Genome Similarity Track
Location :
Scaffold_18:6602- 8153
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.2U4/U6 small nuclear ribonucleoprotein Prp31

Sequence
1551 bases(100 bases per row)
ATGGCATCGCTCGCCGATTCGTTCTTGGAGGACCTGGATGAACTGAGCGGCGGCAGCGACAGCGAGAACGAGGTGGCGGACGTCGGGGCGTCGGGGGACG
CGTCCGGGTCGGCGGCTATCGACGACGAGGGCGATGACGACGAGGGCAAACCGGACGCCGCGTCCAAGAAGCGCGCGTTCGGCGAGGCGTTCGCTGAACC
CAAGAGCCTTGATCTCCTGCTCCAAGTCGGCGACAAGAAGCGCGACGTCTCGTCCGTCGCGCACCTGAAGAGGACGTCTGCGTATGCCGAGCATATTGAA
CGCATCCAGCAGTGCGCGGCGGCGTCGACCGTCACGCACGCGGACCAACTCCCCGAAGGCAGCGCCGAGTACGAGCTCGTGGTGTCGTCAAACGACCTGA
TGGTGCAGATCGACGACGAGATCGCGGCGGTGCACCGCTTCATCGCCGAGCTGTACGCTCCCAAGTTCCCCGAGCTCGACTCGCTCGTACCCAACGCGCT
GGACTACGCTCGAGTCGTGCGCGCGATCGGCAACGAGACGGATCTGACGGTCGTCGACCTGTCCAAGCTGCTGCCGAGCACGTCCGTCATGAGCATCTCG
GTCACGGGCTCGGGTACGAGCGGAAAGCCGCTGAGTGCATCGGACTTGGCGCTTTGTAAGGATGCGTGCGACGAACTGTTGTCGCTGAACGAAGACAAGG
ACATGATCCTGCGGTTCGTCGAGAGTCGCATGAAGTTCCTAGCGCCGAATGTGTCGCAACTCGTCGGGACGCGCATTGCAGCGCAGCTCGTGGGTCTTGC
AGGCGGCGTCGCCAATCTTGCGCGCATTCCGTCGTGCAACTTGCAGGTGCTCGGACAGGACAAGAAGGTGCTGAGCGGCTTTTCGTCAACTGCCGCGCTC
AAGCACACTGGCGTCATTTTCTTCTGCGACCTCATCCAGAACGTGCCACCGTACCTGCGGATGAAAGCGTGCCGCGCGGTTGCGGGGAAGATCGCGCTCA
TGGCTCGCGTCGACAGCCAACCGCACCAGAACGACACGGAAGGGCTGGTCGGCGCACGCTTTCGCAGCGAGCTCGTCGAGAAGATGGAAAAGTGGCAGGA
GCCGCAGAAGGCCAAGACCAAGAAGGCACTGCCGATCCCAGACGAGAAGCCGCGACGCAAGCGCGGCGGTAAGCGGTACCGCAAGATGAAGGAGCGACTC
GAGATGACGGACGTGCGCCGCGAGTTGAACCGCCAGACGTTCGCGACCGCCGACGAGGAGTATGGCGACAACGCGATGGGACTCACAGCTGGGCGACTCG
GCCAAGAAGGGTCGGGGACGCTGCGCATCGCGCGCAAGGAGCAGAAGCAGATGACGAAGAAGCTGCGCCAAGCCACGTTCGCAGCTGCCAAGCAGGCGCC
GCTGTCGGGACTCGCGTCCAGTCTCGCGTTCACGCCTGTGCAAGGCATTGAGCTGATGAACCCCGAGGCTGCGAAAGCGCGCGTCGCCGAGGCCAACAAG
AAGTACTTTTCGGCGCAGAGCGGGTTCGTCAGTGTTATCAAGAAGCCGTGA