Description :
From Genome Similarity Track
Location :
Scaffold_185:66001- 70174
Transcript NameFunction/comments
Physo_144409Pol protein
Physo_144410reverse transcriptase

Sequence
4173 bases(100 bases per row)
TGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGC
CTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATG
TAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCACAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGA
ATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAACCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACA
GACGTCGTATCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCAC
GTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACGACCGCCC
GCCGCAACAGAGGGTAACCTCTCTGTTGCTTAGTACCATGAGCGCCAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACTCAGT
CGGGGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTATGGGAGTGACGACGTAGAGATGGAAGAGGGCGAGACCTTTTCCAACAAGCG
CAAGGAGTCTATCGACATTGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCATGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGC
GGCGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTCCCTGCGTGAGGTGGCGTCTTCAAGTTCTCCGCGCGCTGCTCAGGCAGCGCGCGATC
CGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGATCCACGATGATGC
TGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCACGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCCCCAGCAAGAAGACC
TCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGATGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACCGTGAGCGGG
TTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTCTGCGGACGCTGGTATTCCATGCGCTGTGCC
CGAAGGCCATCAGTGCACGTTGTGTCTTCCGGGTGCGGTGCGCTTGAGCGACCGCGGCCTAAACGGGTACACGACGATTCGTGTACCTGAGAGTCTCAAG
GATCTCCGTGCCAAGTTCCTCGCACGAGGAACGCGACGATCGTGGGACCTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCGGTG
CGTGGTGAGCATCGTACGCCCTCACCATTTCCGGAACGTCCTGCAGCAGGACGTCCCGCGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACG
AATACGATAACGAACCGGTTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGA
GGCGGCGGTGGTGGGAACACGCCCCGGGTATGGTCAACCTGGGGTTGACCTTGGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAACAGCATCAGAGC
CGGGAGTACGCCGCTCTGAAGCAGGAGGTGGCGATCCTGAGGGCTCAAGTCGCCCAGGCTTCGCAGACCGCGTCGGACATCTCTGTCGACGTGGGAGGTC
GCGTCGCATGCTTGGCCCAGCGCGTTCACGCGCTGGAGCAGAGGTTTGCTCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGGTAGGTGGCTCGTGCTGC
CGGTATGGCTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGTGA
ACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCAGAAACTGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTCTT
GAATTCATTGGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGAATGACGGCTTGT
CTGCGCTGCATGAAGTTGATTGCGTCCGAGCTGAATTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCT
GCACAGACCCGTTCTTCTTCTTCTTGCTCTTGTCGGCGTCTGTGCCCTGCACAGACGCGTGCTTCTTCTTCTTGTTGCGCGTAGTCGCGGCTGACACTGT
GCAAGTGTCAGCGGCATTCTGCGGCTGCTGCGTTGCAGTCTTAGATCCTCCCCCACTTAAGGAAGGAGCCATCATCCCGAGTAGACTCGGGAGGCGTGGG
TGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGTCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGGCACTCGCACCAGTGTT
GGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGTTCGGTCTGCCCGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAG
TTGATTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCCCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAAC
GCCATGTCAACGAACAGACGCGCCGTCTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGGTACATCTTGCTGAAGCGGTCAACAAAGACCACAA
CGCCCGTGTTCCCCTGGCTATCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTCCGACGGAGTCGGCAGTGACTGCAAGGGAGC
CTGCGCGAACGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGGCCCAGTAGAAGTATCGCGTG
AGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGA
CAACGCGATCCGCGTTGTCGTCGACTGCACTGTAGAGCAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAACTTCTG
ACGAGCTTTGTCAGAGGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTC
GGGTGCTCGATCCCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGTGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCC
GGGTTTGTACTCAACCCGGAAGTTATAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAACGACGCGTGGTCCGT
ATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCT
CAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGGTCGGGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTC
ACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCA
GTCCAAACCCACTCGGCGGCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGAGTAGTCCTTCACGT