Description :
From Genome Similarity Track
Location :
Scaffold_185:66001- 67400
Transcript NameFunction/comments
Physo_144409Pol protein

Sequence
1399 bases(100 bases per row)
TGTAGTGGGCCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTAGTTTAAATTAGAGTTAATTATACTCGGGC
CTCCGAGTATAGATTAATCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATG
TAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCACAATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGA
ATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAACCTTTGGTGTGTCTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACA
GACGTCGTATCTGTTAGAGTTACAAGTGACTGTAGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCAC
GTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGGGAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACGACCGCCC
GCCGCAACAGAGGGTAACCTCTCTGTTGCTTAGTACCATGAGCGCCAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACTCAGT
CGGGGATTGTCCTCGAAGGTTCCTCTGTAGTCAACGACGCCGTTGACTATGGGAGTGACGACGTAGAGATGGAAGAGGGCGAGACCTTTTCCAACAAGCG
CAAGGAGTCTATCGACATTGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCATGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGC
GGCGAGAGCGAAACTCCGCTCTCCGCTGCTGGGGCTTTAAGCTCCCTGCGTGAGGTGGCGTCTTCAAGTTCTCCGCGCGCTGCTCAGGCAGCGCGCGATC
CGTGGATGCCGTCTGCGTCAGAGATCGCAGACCGTGTGGGCAACACCGTGCCTCCAAATGAAATTCCGCTGTACGTATGCAGCGGGATCCACGATGATGC
TGTGGCGGAGGAGCAGCACTTTGATCCGTTAACGAATCAAAGGCACGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCCCCAGCAAGAAGACC
TCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGATGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACCGTGAGCGGG
TTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTCTGCGGACGCTGGTATTCCATGCGCTGTGC