Description :
From Genome Similarity Track
Location :
Scaffold_1372:660- 4459
Transcript NameFunction/comments
g9754.t1hypothetical protein
g9755.t1hypothetical protein

Sequence
3799 bases(100 bases per row)
CCGCGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCATTCTGGGAGTCTACCCACA
AGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAACAGCGTCGATCTCGCGCTGGTCCCCGGTGGCA
GACCATCCTCAAGCATCTACTGGCTGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAGCGAA
CGGTGCTTTTGGTACCCCGGTTTCGGAGCCACGCGGGCGCCTCCTGACTTAATCAACGCCCTTCCTACCGCCGATTCTGCCGACCCGTGGCGCAACCAAT
ATCGCACACAACTGAGCGACCATCCCGGGTCCCGCATCGCACGCCTAGACGGTAAGTTTCGGTCCATCGTCGATTCTGAGTGAAGTCACCCTCTCCAAGG
TCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCAC
AAGTCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTT
CCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAGTCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGAC
CCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACTCGTCCGTAGCGCGTCCGGCGGCCGGTTCTTACACCCGCGATCTTCTCC
ACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAGGAGGGCCTCATCGAAATCCAGGCGATCGCTCTCGGCCACAAGCAACGGCG
CGTCAGGACGATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCTATACTCCGAACCCGCGATCTCAAGACGTGCGGC
GTGATCGTCGATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCGAGCTTCCGTGCATACCCCTCCTTGACTCGATCGAGGTGTAGCCATACC
TGAGCGCCCACCGCGATGTTGTGGGGTCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCACGAACCTGTTCCCGCG
CTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCACCGACGGGGCTCCTGATCACGTCGGCGCGTGCTGCCTAACGGTAGCGCTGCCTCCAGTGTCGATCG
CGGGTCCCACCCATGGGCCAAGTAGAATGGCGTGTCGCCACGAACTCGATCCTGGGCCGTGTTTAGAGCGAACGTGAGTCGCTCCGCGTACTCGTCCCAG
TCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTCAGAGTCTGCACCATTCGTTCGGCAGTTCCGTTGGCTTGCGGCCGGTACGCCATCG
TAGCTCTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAAGAAATCTGACATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTGGCGCCGAA
ACGTCGAAAGACGTATTCTTCGTAATTCTCGGCAATCGTTTGGGCCGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAG
ATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCAATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCG
ATTCTCCCTGAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTG
CGCCTTGACGCGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGATAATGATGCAGGACGTCTTGTTGTAGCGTCTCCGGGATG
ACCAGCCGCGCGAGGGAGTCCCGGTCTTCGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCTCGTCCAGCTCGTAATCGCAAGCGGTCT
TGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGATCCACTGCTCTTCGTCTTGGGCTTGCGT
GATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCTCGGCACTCGTCTCGACCGTCGTGCAGATCGCGTTACCGCTGATACACGAGCT
ACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTACGGTTCCTTCGCCTC
GTTGAAGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAGCTCGTGTCTCGGCCACGATCGGAGCCGATCCATCGC
TTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATTTCACCACGCATTTGCCGGATCACTAAATTGGAGTCTCCGCAGATCACGACCCGCCCC
CTGTCCATAGTGGACAGGAGATCGAAGCACAACAACAGTCCGCGATACTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGA
TCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGCTTCATC
CGCTTCGACCGTAGGGGGTGGCAGGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCAATCGCGATCAGCGCCTCGTCTACCTCCGCGCGAGGTGTGATG
CTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCCAGTCTCC
CCTGGAAACCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTGTAATTCACGTCTAGCAT
CCGCAGGAGTGCCAAGACCTCCTTGTCGACAATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCA
TGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGTACCGGGGTGGACA
CGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCCGGG
GATGGACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAAGACAGCGGCGTAGACCGCGAAGTCTTCGATGAAACGACTGTAG
TAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTCGGATGGGCTTCCAAACCGT
CGACGGACACTCGGTGTCCCAAGTAGTCTACCTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTCGCAAGCATCGAGCA