Description :
From Genome Similarity Track
Location :
Scaffold_3504:66- 2331
Sequence
2265 bases(100 bases per row)
TCGCCGCTTGCGACCCGCTAACAAACACAAGCGAAGATTAAGCCGAAACGCTATGCATTTGCAGAGGCACCCGCTTAAGCCAACACCGTACCTAAACTCA
AGCCCGCTAGTCGAAGAAACAAGAAAGAAAACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCA
GGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTCTACGCGATTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACG
ACAGATCGAAGATCCAAGGGAACCGGTGGGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTCTGTTTACGGAGTCAGGC
ATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCA
CCGGAGAAAGGTCGCGTACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGCCAGATAC
GTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAAAGCGAAG
GCTCAGGACCCAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCAGATCGGGCTC
AAGGTAACCGCCTCACGGATCCTGTCTCGCCAGTGGAACAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCCGC
GATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCCCAAGTGCAAATGCTTCACGAACATGGAGCACGGGACGTGGAGATGGAGTCAGTA
GAGGGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCCACAGCCGGGGCAGGTAGAT
CGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAA
AGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAG
CTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATG
CTCGCCGCAGATCGGATGATCCCCGTTGGATACCTACATCGACTAAAGTGGCCGTCTACGGCCAGTGAGATCAAGATGGGGACCAGGTATACAGGAACAG
TGATCTTTCTGGGACTTGGGAAACGGAGTTTTGGGCGAACAGGCGACCCCTTTTAACTTTTTCCAGAGGACAGAGAGCTTGAAAGAAGTGCTGCGGGCTA
TGATTCGCCGCGAAAAACCCCCCCCACAGAGAGAGAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGGCGCCTACGGTTCCAGCTCGACGT
GTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGCTCGGACTCCGACCCAGAGGATTACCGTCGAGTCTGTCTCACGGCATCCA
ACGATCGAATGGCGAAGACCGGAGACAACTCTTGACTGGGGGATACCGTATCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGC
GCCAATCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACAAAAGCTGGATATTGGAAACATCTGGTTTGCGAGAAGTGTGGCAAGAAAGGTCATCCCGGA
GATCATTGCTTTTACGTATGTCGCGGTTGTGGCGAAATTCATGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATAGCCACCGAATAGATCC
AGCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGAGGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTATT
GCATTTATGCATTTGTGAACAAGACATCGCTCGATCCAGGTAGCAGGACCCTAGATCCAGTCGAT