Description :
From Genome Similarity Track
Location :
Scaffold_3942:66- 1742
Sequence
1676 bases(100 bases per row)
GGATGACCTTCTGCACACTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCC
GTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCATGTCTTCGCCGTTCGATCGTTGGATGCA
GTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAG
CTGGGGCCGTAGGCGTCGGAGCCTTTTAGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCTCGCGGCACTTC
CTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATC
CCCCATCCTTGATCTTCAACTTGGCCTGTAGACCGGCCACATTTAGTCGATGTAGGTATGATAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTA
TTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATAC
CAGCTCCTGGCTGGCCCCGCTAACAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTGCTGATCCA
TGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCC
CCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCCTCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCA
TCTCCACGTCCCGTGCTCCATGTTCATGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAA
GTGCCGTTGCAGGGTGCCCGCGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCT
GACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCA
CAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTC
ATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTT
AACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTC
CGTAAGCAACGTAATAGATCTTTGACTGCCACAACTTGTTCGCCGGTTTCGTTGGGCTCTCACCGGTTCCCTTGGA