Description :
From Genome Similarity Track
Location :
Scaffold_4106:66- 1524
Sequence
1458 bases(100 bases per row)
TTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACT
TTGACCCGCAGGGGTTGCTGACTCGCAGTCCCCCCTTGACCCAGGTCCTCGAAGCGAGGGCCAGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCC
ATACCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGATCCCGGCGCCATACGCCGAGTACGCTGAGTACGC
CGGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATTCGAAAGGCCTCGTC
CAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGATGAGCGAGCTCGCCC
TGATTCCCGGCCTGGGCAGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAAGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCT
GTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGATGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCGCTGCTTGACCGGA
ATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGA
GAACTCGTGGGAGCCGATTGAGCGGCTCCTGATTGACAGCTCGAAGGCTGTCGCAATCTGGAAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCT
TCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACG
CTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTAGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTAACTCCGTGAGTGAG
TACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGGACTCCACGTGGGACAGTTCTCGGGCATAACTCGAGAACTGTCCCACGTGGAGTCCT
TGTGGTCTCGGGCTTCTTATGACAAGTAGTGAAGTCCTTAAAGGGAATGCGGTCTTGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGATGAGC
AACTGTTCTTTCTGAACAAGTGCTCGTTCATAGATGCCCCTAGAAGTGTAGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAG
CCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCT