Description :
From Genome Similarity Track
Location :
Scaffold_1977:66- 1078
Sequence
1012 bases(100 bases per row)
CGCGTTGAGACTGGAAGTACAAGATCTCGACGTCGTTGTCGCGAGCCCAGTTTGCGACGTTGAACTTGGCGGAAGCGATATAGCAAAGCAGGTCTCTTGC
GCACAAACTTGGTGACGGCTACAGCTCTTTTAAGGACATCGGCCAAATATTGGATGGAGAACATATCTTTGAGCACCAAATTCAACGTGCGGGCTGCACA
TCCATTGCACGTCAGGATTGGTAATTTGGCCATGAGAAGTTCCCACGACTTGCACATATTCGACGCATTATCGGTGACCACCGCAGCCACCGAGCCTTTA
CCAAAatagcttcaacttctccaatTACTTTGCCAAAGCTGCCGCCATGTATTCACCAGTGTGTTGATCAGCTCGAGTACGCACAGAAGACCAACAAATG
GGGCGAATAAATGGTTATAGCACCATAAAGTTCACGGTACTTTCATTGTTGGGGTCTGACCACCCGTCGCAGACCACAGTAACGGTATTTTCGCCTTCCA
GCGCAGCTTTAACGTTCTCTTTCTCCTCATTGTATGCCTCCTCGAGTAGTTTTGTCGCCAATTCTTGTCGTGTGGGAAGTGGCATGCCAGGACGATAGCG
AGTCAAAAGAGCGCACATTGCCGGGTTCTCAATAACGCGAAACGGGATACCAGTAGAATAGAACGCCACCGCAACAGCTCGATGatactccttcttctcc
gttTTGCATACTGGCTTGTGGGCTGGGGTTGAGGCTTCCACCCGGATCCGTTTAGGAGAAGCGACATCGTTTGGAGCATCTCGACCTCGTTTACCAAGAA
ACGACAAAAACTTAGCTCGGATACGTGACGGAATTTTCGGACAGCGATCAATGTGGGGGACCAGCGATTTTTTCGGCTGCGCGTGGCGTATAAGTTTGTT
GCAGTGTTTGCAAGTTACGTCTGGGTGTTGCTTCCCTCGGTATGACCACCTCGGAACTGTGATCTCAAACTCGCTCCAGGCAGGATGACGTGGGGAGCTC
TGACGCTGGTGT