Description :
From Genome Similarity Track
Location :
Scaffold_53:65998- 85729
Transcript NameFunction/comments
Phymu_g2835hypothetical protein PHYSODRAFT_262124
Phymu_g2836conserved hypothetical protein
Phymu_g2837hypothetical protein PHYSODRAFT_509593
Phymu_g2838hypothetical protein PHYSODRAFT_286379
Phymu_g2839conserved hypothetical protein
Phymu_g2840conserved hypothetical protein
Phymu_g2841protein kinase, putative
Phymu_g2842conserved hypothetical protein
Phymu_g2843hypothetical protein PHYSODRAFT_286376

Sequence
19731 bases(100 bases per row)
GGAAGATAAAGCGTATAAATGATATTATCTTGTTGCACTCGGCTGTTTGTTAAGACTTCTCTTGAGGTGTTACTACGGATTGCCGCGGAGGCGCAATAAA
TTAGGCAAGAAGCAGGTTGACAGATTCTTGCACGTCTTGTCGGTAGGCGTCATCAACCAGGACATCTTCAAACGACACTCCGGGCGTGTACGGCAGAGGT
TCCAGATCACACAGCAGCGAATCCATGTCGACATCCAAGTCTAAAGCAgaaaagctgctggtactgctgccGGAATCGCTTGCTACAGGGCTGCAACCGC
CCGTTAGTAGCTGTCCGAAGCCACCGCTCATTGGGGACATGGCGCTGATGGGAAAAGCCGACGGAGATCGCGGCGATCCCTGCACTGTAAAGTTCTTCAC
GCGCTGGATGCAACCGGTGGCATGGGCGTCGACGCGGTGCTCGGGGCGAacgaatttcttcttctgtttgcGCAGACCACGTCGCCGGCGGTTGAtcttc
tgctggtacttctgCGCGTGCGTCTGCACCTGTTTGATGGAACGCGTGCCGATGAAAGCGGCAATGGAGCGCCACGGGCCCGTCGGGAACATCTTCATGG
cgtgcaggaactgctcGTGTTCCTGCTCAGACCAGAGTCCGCGCGTGATCGGCGTCGAGGGCGCCGGAGAGACGACGAGGCTGCCTCCGTGGGTGCTGGT
AGGCATCATCATTACGGCGGTTGGAGTTGCTATGGTTGCTGTGTTGGTGCTGCGAAGTGCGCGGCTCAAGCAAAAATCGGAAATGGAGCTGAGCGATTGA
TGTGATTAGGCGGAGGCCGCTGGTCACTTTTTTAGCTTGGCTTCGCCTTTGACACGAAGGTGGCCCTAGCCGGGCGAAAAAAGGGGATGGGCAATGCGAA
AGAGGGTAGGGGTAACTTATGGCTCAGAGCGGTCCTCAGCGAAAAGATTGACCAATGGCAGCTGGGTATCCCGCCGGCTCGTCTGTTCAGTTCCGGTACA
GTACGCTGCGGTATCTCAGATGGAAAATGCTTGCTAAAATTATCGACGGTAATTTACGAGCGCTTAGAAGAATTCGCTGGCGTGGAGTGAGAACTGCCGC
CAGAAGGCGGGCACTGACGTATCCGCATGCTTCCCCGGCCGATGGTCAACACAACTGAGTGTGCACGACTTGAATGGTGAAAACAGCTTTTGCTCCAAGC
TGCGGCGCGCAGTAGTCGCGGCGCCAGGCGACATACAAAAACGCGATGGCCGGTTGCGGCTTGCCTCAGGCTATCCAGGAACGGTGGTCAgaaagatgct
gctgctattgcttGACTTGCCAACTTGCCAATATGTTGCCATTTCATTTAAACAAGCGCTGCTGCCAGTTGTATCACCAAAGCTCACAACGGCAACGCGA
AATGCATTTCGGAGCGTTCTCCGCTGACAACAGTAAACGAGTTCGGACACGATACAGCATCGCAGGCGCTGTGACGTAAAGGTCCCGGCAGGTATATTTT
CGCGTCGACGTTCCTCGTACTCGCCTGTTTCTCTGAGATCACTACAGTGAAAACCTCTACTCCAGAGGCACTTGCGGCTCTTCACCGTATGGATAGCGCC
ATACTCCAGCACAGATGCTAGAAAGCTTGGCTCATAGTGATTGCTATCAGTTGGAACAGCCTAGCTAATCGCAcagacagcagcatttcAGGCGACCCGA
TGTCTTATCGCGTATGCTGTCTCTCACCCCGAGGCCTGCGCCGACTTGCTGTGGCAGAAGCGTTGGAAATGCAAGAATCTTACCTGCTGATGACCACAGC
CTGACTAATCCTCGTGAAAAACTAGGCTAGCTCCGATCGAGAATGAAACCAGGTGCCTTCATACGTCACATGAAAATCTCGGCACATTTTGTGTTACCCG
TACGAAAACAAAATAAATAACTTCGCTATCCCCCGTTCGAGCATGTGCGTGTCGCAAAATGCTGTAACGGAGTCCAGCGTGTTGCTTCCTGGCGGTGCTG
CGATCCAGAAAAAGATCGGTCTCCGCGCTGAAGGTCGCaggcgttgaagttgactgTACTGCACTGCGAATCTGTTTTTAACAGCGCTTGACCAACGGCA
CTGCTGCGAATTCACACACTACTGGCGTCGTCCCAGTTCAGTACTCGGCCTGCGAACATGACGCTCGCTTCGGCCGGCTTCCTTTCGCAGGCTCTTTTTT
TTCCTCCTTTCGCTTGTGCGGAGCTCGCATGGTTTTAGTCCAGCAGAGTTGCATGGACTGCATCAAGCGGGCATCAGCTTGATGCTGACTCCGCTCAGTG
AGCTGGTTGTGTATGAGACACCGTTCGTCGCTTCCACCAGGAGGCATGCATGCAAGCTTCATCTTTCCATGGTGTGATGAGGCCGCAACACCGCTTTTGG
GAAGCGCGGCCGCGTCCTGCGACGCTCGCCGTGCTCTTCCAAGGAAAACTCGACCGAACATGCTGACGTTCTCATCAGGTAGCTATACATTTTTAGGTGG
ATTCCTGTACTCCTGCTTGTGTGGGTCTCGGATAGGAGTGATGCAACTCTCAACTTGAGAGCCTACAATGACGGCTTACAATAATCGGCACATGCAGATA
AGAAAAATGCTCTTAGCAGGCAGTCAGCTTGGAGCTAACACTTGCTTCAACGGCGTTTACTCCAGAGTTTCAGAGGCAGGACTCGCACTTTGGAAACTTG
CCCTTCGGGATGAGTTCGATGAACGAACTTTCGTCCGCGTTCGTCGGCAGTTGGGCTGCTGACTTGATGTGTGTATAATTCGAAATACTTTGAGCACCAG
CGTTCGCAGTGTCTTCACGCGCGAAGTGCCCATCACCGCGGGACCAAAAATCTTTTTTTGTGGGCCCACACAAAAATTTGTTGTATCCGCTAGGCGACGC
TATAACGTAGCGGCACTGGTGCcgcttgacgtcgctggTGCGATGCTGGCTGCGGTCGGACGCCGCGGTCGGGATCTTGGCTGCGTGCGACAAGATCTGC
CTTCGCCGACGGCCGTAGAGCGAGGAGACTTAAAGCGAAAGAGCTGCAAGGCCGTCTCATAATTTCACGAGCGCAGGTGCAGGCCGCGCGCGAGATGTAG
TCGGAGCTGGGATACATGTTGAAGGCCCTGCACTGTAGTGCAGTAGGGTGCTGCGAATGACAGTCTGAAGTGTAGGCTGCACACTGTGCAGTGCACAGTA
GCGGCAGAGGACTGACCCGACGAgatatacatgtagtgacCACAAATGCATTACATTTTGTGTTGCAGGATGGATCCAGTAGCAGGCAGAAACGCTGTGA
TGATGCGAGACTACCATTGCATCCCTAAGAAGTTACCTTGAGGGACGGGCGAGTCAAGTTCGGGGAGGTTCGGCACTGAATCAGCAATGCTCAAGACTTT
AAAACGTGCGGGTCGGCCGTCGCTGCCATTTCCCGACCGGTGGGCTGTCCATCTGAGCCGTCTGCCTGGGGCAAACCATTCGGATTCGGGGGCGCTCACG
CAATGCACGTCAATTTGAGACCAGATCACGGACGAGATTTGTCACGGCCGACTTCCTTTGTCTCAACTTCAGCGGTTGCTCTCTCCGCGAGGGTATCCTA
GCTTTAGCTAGGTAGGCCAAGAATCGCTTGTCGGATGCCAAGGACCGTTATCTGCGAAATACAGTGTCATCAAGGCTAGCAGCCATTGAGTCAACAAGGG
TCAGCTATAAAATGGCATTAAATCATTAGTTCACCAGAGACAGCAGATCACGACAACCTGCTTGGCTCTCAGCACAATCACACTTCATCCATTTCAAACT
CATGCTGCAGCCGACTTTCGCCGCTGCTTGAGTGGCGGCttgctctcctcctcggcaTTTGCATCTTCTTCCGTCACCTCCTCCATCATTGCATGCTGCG
TTACCGCCACACTTTTCCTCTTAAGACTCTTACGAGTCtctgccgccgccgcgcgCTTGTCAATTTCAAACTCGAACCCCACAGGCGTCGTGAGTTTCGG
ACGTCGAACAGCCGGGACTCCAACGCCTCCACTTGCCGAAAGAGCTTTTGAGAACTGGTCACTTTTGCCTGGGGCCGTTCCGTGTGTTGTAGCGTCATGg
tacttcttcgtcttgcgcttctgggCCTGTACTCGCTTGCGGATGGCcgcgatctccagcagctcgcgaGACGTCCGCGTCAACATGTCAGCGCGGGAGC
GAGGCGCAgacttcttgagcttgtgtAATTTTGGGGACTGAGGGATCGTCAGTCGtccgttctccttggccacgcGCGCTAGGCGCCGACGTTTACGCGC
CGTCTCGCGCGCCTCTGCCAGTTCCTTATCCTTGCCGgtcagcaccttcttcctTGATCCCGccagcgacgccttcgtggGCTTCAGCAGGCGGTCTGTG
GACGAAATCGCGCGCACTCGAGGCACGCGCGTAGGAGCGCCACGGTACAGGGCGTCTGGGTCTTCATCATACATGGGGCGCGGTGTCTTGGCCATTTTAG
CTGAGCGAGACGATGCTTGTGCGGAATTGGGGCGGGAGACGACGGGTTCAAAATTCAAATTaatattttgttttgacCAATCGGATCAGGTCAATTCCCA
GCCAATGGTAAAAGGGACAACCTATatgaagcacttcaacatccGAGAATTGATCAtgcgttctccagctcgataTCGACGAGCTGTCACCGTCCAGGAC
GACACTGTCGATGCACCTACTGCTGTGCAGGCATTGCACGTAACTATCCCACTCAAACCGCAGCAAACGCCGACTGCAGTACCGCCTCGACTGACTCAAG
CAGTCAAGGACGAGTTCGCTATCCGCTACTTGCAAGGCATTGGCGCAAGCTCCACCCCCGAGAATATTGCAATGGTGCTGCAACACCTTCCAATGGAGAA
ATGCGCTGTTACAGCCGCTTGGAAATCCCGTGGGTCCCTGTCTGACGTGTTGGCGATTGATTTGAACCCGAAAGCACTTACTCTAGCAGGACAAACTCCA
GTAAAACCAGAAGGAAGACCAGGTTCtaagcgagaagaagcgagcgaTACTTCTCCAATGGTGGCATTGTTATCGCCACGACGGCAAATCCGAGGCCAAC
AGGCCCAGCACGTTTTTCAAATTGGCACGGTATGTTTCACCTTCGACGACATGAAGCGCAAATTCTTGCTGCCGTTCAAGTTGGCCACACCGTTACCTCA
ACCTGACGTGTTACAGCTCTATGGAACTCACACAGAGATCGGTGCTGACTTAGTCGGTACGTTATCGCTAAACCAGGCAGAGGAACCAGCATTAAATACG
ACGCCTGGCTCACCAATAGCTCTTGGCGCTATCGCCAACAGGGAGGCACAGCGACGGCGCGCATCTGCAGACGAGCGCCGAGTACCACCAGAAACCCGCG
CCGAGACTGTGGCCGACATGCACAATGAGTTCTACCTTGTGCTGCCATTAGCCTCATTAGGCTTGACTGAGGGTGACGAAGACACACGGACTGTACTATA
CGAGGCTCTGCTAAGCCCTGCTATGGTAGAGCTTGTCCAGAGCACACTTCGATATCTCTTCCTCACGGTGATACACACTTCATCAACAACTACAGAACAG
GGGCGAGCCGGCACCGAGCAAGACACGCTTTTTGTCTCCATTGCGCAGAATTTCGCTATGCTCCGATCCAAGTTAGAGCGTAAACAGCGCTCCACTTCCC
GACCACAACTTGCTGTGCTCGTGCCACTTTTGCTACTGGCGCTTCGCGTAGACGTCGAGACGCTTGTTCGTCTGCAGTATCCAGTGAGTTtctcttgtgc
tgctgcagaaatGGCTCTACTGCTTCAAGCACTTGACGCTCGAATCTCGCAGTTATTAGATCCCGATGCGAACTGGAGTCGCCTGGCTGCGCTGGAGACA
ACGCATGAAGCTGGTCAAGCACGAGCATCCTCTACCTTTCAGCATGCACGTCGGCATCGGCATCTCCGCGATCAGTATTTCCAGACGAGCTCGGTACTGC
ATGGCCTCTTTCCAGACCCTTCATCCGGCAGATCTCGTCGCGTCATGGCCTTGCGTGGTGGTGCAGGCATCAGTCATTATCCCAACCTCTCCAAGGCCAC
TGAAGCTACCTCTTTCACatcttcgtcagctcctaagcacgaagatcttcgtAATCCAGACACAGTATCCGTCGCGTCAAAACTCTCCCTGCTCAGAAGT
CTGCGACGCTCGCAACAAACCAAAGCACCACAAATCTCTCAAGGACGTACGACTAATACATTATAGCAAAGGGAACACATCATATTCTTTCTCAAAAGCT
CTGAAaaagaagacgctgtcgCACCAATGAATTAAATCCAATCCAAGCGGCGTCGCGTCAACACAGTGGCCTCTTTACTTGGTGAGCTGCTcccacagct
tctccacatcGCCGCGCGAGTTGGCCACGACGCTGCGGCCGTCCATGGTGATCACCTTGCCCTCGCTATCCACGAACACCAGCATGGGGATTCCCGTGAC
GCCGAACTTGGTGCTCATGGCCTGGTTGGCCGTACGCTCCTCGAAAGGAAGAGCCAGGAACGGCATCTCGTTGAAGTACTCCGTGTACTGCGACGGGTCA
CGGTCCGACGAGATAAAcacgagctcgaactccGGGTGCTCCTCGACCATATCGTCGTACACGGCACTGAGGAAGGGCGTGAACTGGCGGCACGGAGGGC
ACCAGTGCGCGCTGAAGTAGAAGCCTACCACTTTCTTGCCGGCCAGCTTGTAGTCCGTGTCCTGAAGGCCGTCCTTCGTTAGGAGCTTGGCACCGAGCTG
TTCCGACCACTTCATGTTGTCTGTGTGAATTGCTTTGAGTCTCTTCCTGGGGGTTCGATTGGGAGTGAGAAGATCGATACTTATCCAAGAAAAGAATACC
GTGAGAGACACAATAATACGAGATGGAACTCGATAGTGAATCCAAGTAAGCTATTGCCACGTGGTTCATCACTTCTTTCGGACTGGTAACAGCGCCAGTG
TTTCGTAATCTGGGTAGGAAACGTCAACCCAATGAAGTAGTACCGTGGAGGACAACATTGTCTGGTATACGAAAAATAGCAGTGCATTCCGTCACTACAG
TCATGTCGCCTAAGTTTATGGAGATGTCGCCCGCAAGCAAGCTCCGTTGCAACATCCCGACCAAGCTACTCAATTGTAGGATGTACACACGTCTGTGGGC
CGCTCTATCTATTCCTCTGCAgtcgtctcctgctccaactgcttcttggcgttctcgcGTGCCAGTTTCTTCGTCATGTGACGGTTCAATGGCTTCTTGG
ACGGGTCAAACTCGCGCAGAATCACGGTCAGGTGCGTGTGTGGGTGGTGCATCACACCCGAACGACCTAAATTTCAACAAATTTGTTAGGTCATCACACT
CGtcctgaaaaaaaaaaaaaaaactcttGCGTCCGCACCTCGGCCCATGATTCGCAGACGCTTAAGGAAGGTGCCCTTGTTCACAAAGCACTCGGCCACC
TTGAGATTCTCCGGCTCAATCTGGTACTTGATGTCGGCCAAGTTGATAGCATTTTGCACCGTCTTCTGGAAGATCTCGGCCTTGCGCTTAGGCGAGAACT
TCATCTGCAGGATAGCCTCGTTGGCCGGAAGTCCACGAATCTGCTGGGCCAGGTACGTCAACTTGCGGGGACTAGCGCGGATCGCACGCTTTACAGTCTT
GACAGTGCGCGGCTCCGCGGGGGACGTGGAGCTCAGGAACGCAGCCGTGTCCTCATCCGATGCAGCGGCCTCGCCCTCCACGGCGGTCGTTGATAGTGTC
GCTCGGGTTACGCGTCCCATGAAGGCGCTGCCCGCGGCCGGGCGGAGCGTCAGAGCGCCCATCTGCGAGCGCAGCGAGGCCAGCATCATGTCCGGTCGGT
GAGTTGCGAGGGTTATTGCAGGACCTCTTTGCTGCCACACGCTTGAATCTTTGCAAATTTAATAATTCGTTCGGTATCGTATTTTGGGGTTTCAACTACC
ATTTAACTGATAAATGTTAgaacatggctacacaagtgttgttgaagaagaagaacaagagaAGCCCTCTAACTATTTTTTGGCGGGTGCTATCCTCACT
AGGAAGGACTTGATAAATGACTTAAGATGCGCCCGCTTTATCATCGGCACGAAGACTGAAGTCGCCTGCCTCATCCGTTGCTTCCCACATCACCACATGC
AAATAACGTCCCTAGGTCTCTCACGCAAACGGCGACGTGGTTCGTGTCTTCTTGTCGGAGATCCAGATGCGCAGCTTCTCTAAGTTCTCAGGAGGAACGC
CGTggtcctcttcatcgccactgcCATATGCGCCAGCACTCATTCGATCTACACTTGCACGACTGGCAGCGTTAATGTGGTCCGCATCGTCTGGTAGCCA
CTCAATGTTCACCTCAATGTCAGTTCTGTTTGATACCAACGGCATGAGATATGACACGAATCGCtggcgagctgcaggcggaAGAGATGGGATCTCGATA
CCGCGCACTGTGATCTTGGCCGCAGAGGTGCCCACAACAATGTTGGCAATCCACTCGCCAAGGTATTCAAACTTGTCGGGTCGTCCCTTGCAGATGTCGC
GACGAAGCGATAACAGGAACTCGTCTGTAAATTGCTTGCACTTCTTCTGTAGTTTATACTGCACGATAGCCTCGCTCAGTGCCTGTGTCTGCTCCGAATT
CTCCATGCCATGAGTGCCCAAGTCGTAGCATTCACTGCATAAGTTGTAGTTTGAGCATACACTGCAAGTCCAGAGAGCACCCACGATTGGATCCATACCA
CAGCCATCACAGAACGAATTCGCATGGACGATCGTTTTCTTGCGCTTCCACTTGGAGCCAATAATGGACGCTCCCTGGCTCATGGCTGCACCAAGACGAC
CCATAAGCGGCTTTCCGGGGGAATGCTTCTTGTCAGGAAGACTCTTGGACTGTGAGCCATCCTTGTCATGCACGTCACGCTGGAAGACAAGTGTTCGCGG
GACCGTCGACGATTGAATAATGTCAAATACCTGCTCCTTGGTCATGTGCGGCTCGATGTGCTGACCATTCACGCTAATCAAGTAGTCGCCGACCACCACA
CCACCACGCTGCGCGGGGCTGTCCTTATCCACACTCCAGACCTCGACAAGCAACTCATTCTCTAacgagacgacgacgttcgTGTTGAATCCCAGCACTT
GCTCCGTGAACGTTAACGTGTACGTGTTGAGAGGGTGTTCCACGTAGTCAGCTTCGGATTGCGATCGCAGGCCAGACTTGGCATCTGGGGCGTGAATCGC
GCTCGCACTCGACGAATTCCGTCCCGATGACTCCCCGCTGCTTGTCACGCTACCAGAGCTCGCCGCGACGACGGGTGCCTCGCTAACGAAGCGAGGCGGC
TTGTCATGAAGTGCAACTCGACGCAAGCTGTGCAGTGCGCGGGCCGACGAGGGATCAGAAGCCACGCTGGGACCTAAGAAGCGATGCGACGTAAACTCGT
CTTGACCCTCTCCGAAGTCCGCGGCGCCGCCATAACCCAAAGGTGTGCCGAgatcagcgccttcatcATTATCGTCGctaccagctcctccgtccaTCTC
GTCACTATCGCTGGCCTCGTCGTCAATATCATGATGCACCAGGTTCAACGGGGCCGGCCGTTTCGGCGACGGGATCACAAGCTCCACTTCATGCTCCTGG
ACCTGTTCTTGTACCTTTAGCTCAACCTCGTGAACCTGCTCGCCTATCTCTCCGGCATCTTTAGAATTAACAGGCGACTGCGGCGGCGactgcacctcca
gctctACTTCATGGACAACTACAGGAACAGTTTCATCCTCAAAATTTTGCTCTGGGGGCTGATCTACAGGCGTCGTAGGCTCTTCGTGGTCCTCTACAGA
CGTCGTAGGCTCATCTCGAGGGGTCGAAGGCGCTTCAACTGGCGTTTTTGGAGCTTCCACTGGCGTTGTAGGCTCCTGCACAGAGTCAACAGTATattct
tcatcgtcactgtctGTCCGCGCCTTGTCTGACTCAGCGCCGTCCTCGTGAGGCTTGTGCAGTTCCAGTTGGGACGCAACGGGACTCTTCTCCGTTTCCA
CCTCAGCCTCGTAGCTCTCGGTCGGAGTTGACGGACtcatcgctgcagctgtgaGTTCTCCGATGGCACGAGGCGACTCCACGTGGGGCTTCACGGGCGA
CGAGCTCTCCGCTGCGCTGGCCGAcgcctccatctcttctGCCTGCCGCGCGGTGTAACGTATTGTGGGGAGCCACTTGCGTTCAGTATGGAGGTTCCGT
CGTCCCTTTGCTGAAAAGATAGTCGATGAACTTTTACAAACCTGAGAAAATCGATGTTTCTTTATATGAGTATATCAATACAATTGCTTTAAAATAGTTA
CTTTCTGGCAATGTAAAACGGCTTTCATAATCTGATACACCTGTCTATTATGATATCATTAGTTTTACAAGAAATTGACCTTTAAATTTTTCAATGAAAA
CTGTGCTAAAACGAACGACCTCCGGTCGAGCAGTGCTCGGAGCACAGCGTGAAGCTCAGCATATGGCTACTATCGCATGGCGGCGGCGAAGTATCGGGTC
CTCGTCGACACGAACAGCACCGCATGGGCGTCCCATTGCTTCCGACTAGCCATACGTGCTCGGCGACATTTGGGAACTCGGTCGTTGTCTCGAAAACAAA
TGTATAGAAGCCAGCTAAAGCTGATGGAGGTGTGCAAAATTTGCACCTCTGCTAGACGAATTCCAATCACAAACGCCTCCACACTTGAGTGTTAACACTT
GACTTTATCAGACAAACTTAATTCATTGTCATTCGAACCGACTACTTCACCTACAACTGGGAGAAACTTCCCTGCATTGTCGAGCACTTCCAACCACAGT
TCTGCTGTTTGTCATCCTCGCTCAGCATCATCACCTGAGTGTCCATCCTCAAtgtgtgtttgctgctgcatcaaagCGCAGAATTCCTCATAGTCAATTT
TTCCGTCCTCGTTcttgtctgctgcttgaatGATCTTGCAGGTTTCTTCGTTACTGATGTGCTTGTTGCCGAGGACATGAAGGATGTGCTCGAGTTCAAC
GCTCGTGATGAATCCATCGTGGTTGACATCGAAAGTCTGCGCATAGAAACAAACTGCGTTAGTGGAAATCATCACCATGTTTATCCACAGAGTTGCGGGA
ACGTACATCGAAAGCAGCTTTGAGGTCTCCAGCCGTCAGGTCTCCACTACATGTTGAGAAAAATTAAACTCAATTGCACTTAAGCGTAAGCCGGTCAAAG
AGAATCTGTACAGTACCGACGGAATAGCCGCTGATTCATCATGCTCACGAACTCAGTGAATGAAATCTTCCCATCACCGTCAACATCGGCTTGCCGCATG
ATCTCGTCAATCTCGGAACTGCAAGCAACGTTATGTTGGTTAATTTACTGAAATGTGAAGAAAAACCTGAGACCGAACAAACctggaaagctgctgcccC
AGTGCCAACAGCAtgtccttcagctccttccgaTCGATGCAGCCAGATTCATCTTTGTCAAACAGAGCGAACGTCTCCTTGAACATGTCCATATTCATTG
TCGATGTGCGGTGGGGCGTGAGGTGCTGTTCATCATCATCAGAATTTTTACCGAGTTTAGCGTGTTGCAAGCCCATGACGACCGCCAAAACGTTAGCCCG
TagttgctgcagacgctggtaCGCTTGAAGTCGCTGAGTGTGGCCGCTGTCGAAGGGCTCTGCTGACGTCGTGAGTCCACTGAGCCATGGATGCTGCATG
GCTTGCTTAGCAGTCAACCGATTGGATGGATCTGAGTCCAGCAGTAGCGTCAAGAAGTTCTTAGCATCTGCAGAAAGACTCTTGTACCATTTGTTCTCCA
CTACACGACGAATCGGTAATCAGTACACAAAACTTGAAAGTTTTAGGCAACGGAACTTACCGTCATAACTTCCATTCGCGATCTCCTTCACAATTTCAGC
GTCGGATTTGTCCCCTCGCGGGTCGAATGGATGCACTCCTGTCAACGTGATGTAGGCCTAAAGCAGTACATCGAACATCAGTGCCCCCAAGAACTAAAAC
GGAGGCAAGAAGTTAATCACTTTCATACCAAAACGCCAAATGCCCACATATCAACGCTGAAATCCTGAGGATGGCGTGTAATGATTTCAGGGGCCCAATA
CGCGCTAAATAAAACGCCACATTAGTCAATTGAAGCATTGCGTAAGTGCAGGAGTACTTTGTTGTAAACTTACACAGTCCCATTCGGAAATTTTTCAATA
ATCTGCTCTCcttgtcgctgtcgccgaCTCAAACCAAAGTCCTGGCGATAAATCAAAAAGCGGAAAGTTAATACATGCACTTTATCAGCGGGAGGGACTT
AAATAGCGCCTACTCACCGCTACTTTGACGTTTGCTTTGGCGGACCGGTCGGACAGTAAGACATTTTCAGGCTTTAGGTCGCGATGGCTGCAGATACAGC
AAACGTAAATTTTCTACCACGCCATTTTCGCAGTATAAAAACTCACCAAACTCCACGTGAGTGCACGTAGGCAAGTGCTTGACAGACATCTTGTAGCAGG
TGAGCTGCATCTTGCTCTGATACTGATCCCTGAAAATGGCATTTTAGAATCGATTAAACGCCTATACGTACAGTAGACAATTGCAGACTTCACCGACCAT
ATCGACAATATAGTCGAAGAGTTCTCCTCCTTCGACCAAGTCCGTCAACATGATAGTTTCATTCTTGAGATACAACACATCATGCAGCGACACAATGTTG
CGTTGTGCGCCAAGGTGCCGTAGAATGTCAATCTGTGCCAAATAACCAGCCAGTTGGTTAGTACATAAGCTTCCAACAATTAAAATGCACCTACCTCAGC
CTGAATCGCTTCCGTTGAAGCGCATTTTGGGTCAAAAATCTTGGCTGCCAGCATCTATCAACgtaaataaaaaaacaaaagtTTAAGCTGTTCTGTAGTC
GTAAGGCCGCCTACAATCCCCGATATCGCTCACctcgtccgtcttcatgTCAACTGCAAGGCGAACAATTGAAAACCCTTTTAAAAATCAAAGAAACAAA
CAATAAAACTGTTAAGAATTCCTACAGCTTTCAATTAGCATCAATCCTTCGAACCTCCTCTgccgagctccttcagcagagcGTAGTGGCCTCGCTGGTC
CAttttggagctcttccaccacgCGCCATCGCTCGACCCACACTCGACGTCGCTACTGGGTGTTTCTCGATGCATGAGGTAAACGACACTTAacgccgct
gccgtcgttACGAAGCCCACCCAGCCCGTTCCATTGCTGTACGACGTCTCCTTCGTGTTTGGGATAGGCGCAGGTTGTACCGCAGACGTTGGCGCCGCCT
TCGAACGCACAGGCGCGCGCGTTAAACGCGTTAGAAGACGCATCCGCATGGCCCAGAGCTCGTGGGGTGCACAACAGCAGAACTGGATTTCGGTATTGAA
GCTGAAATTGTAACATTTAACTGAAACATAACTGCATGTTGAAGTCACTCTTCACTTAGCGGGGCGTGTACGGGTTAACTTCCTCCTCGAAGAGATCCGA
CGCGAGCTTGGACAGCGCGTGCATGGCCCTGAGGTCTTCCAGTGATATTTTCTCTCGGGTCTTGGCGTCCAGAGTGCACAGGCAGGCAACGACAGAGCCG
TCCGGTGATTTGATGGGGAATCcggcgaagaagcgcacgccGATGTCGCGCACAAGACGCAGATGCCGCAGTTGAGGGTCTCGTATCGGGTCCTTAATCA
CGAACGGCTTGCCGTTAGCCACTAGAGAGAACGGACACACCGTCACTTCGTCAGTCCATGGACGTGGAGCGCCGGAAGACCCTACGACTCGCTGGGAGTG
AAAACTGTGGGAACCGTTGAGCGCCACAATGTACGCGATGGAGCATCGCATTCGGCCGGCAGCAACCTCGCAGATTGAGTCTAGCGCTGCAGAGTCCAAG
TcttcgtccagatccagttcCACTTCCAGgttcgtcgctgtcgtccatGGTCGAGGCACGACGGAAGGTCTAGTGTTGACCTGCGCCGAAGACGAGAAGC
ACTTGCCGCTGGTACTGCGTCGACGGCGCTGTGTCACTTCCTGACGGTTGTAAGACGAGCTTAACCGACTGTGTGGGGTTTCTCTGTTGAGGTCGCTGCT
CTTAGAAATGGTCGACAGATGCAGACGTGCCTCCAGGTACTTGTCGACCATTTTCCTGTCCGGATACTGCGGGTGAAACACTGGAATCGAAGACGcggac
gttgaagacgatgtcgACGTTGAACTCGTAGGTGCCGAGTTGGACGTCACTTGCTTCACTACTTGACGTACGATCTCCAGTGCTCGTGCTCGGGTCAACG
GGTCGCTTGAAAACAGCGCGTCGGCTAATTGACGGCCGGGcgtcgaggagaaggacgttGAGGCGGTagctgcgctgctgctgcgatcTAATCTGTGCAT
TTGTGCGTCGTATGGTGCTGTTCGGGCATCGGTTGATTGAGAGAAGCGTACAGTATCGTCGGATTTGAGCAAGATGTCGTAGAAGGCGGTTGAAATCTTC
GTATTAGCGGCATCTTCAACCGGCCGAGTGTCCGCGGTGCCAgcggttgctgcagttgaaaCTCTGTGGAGGAGCGGATCATCTTGTTGGAACACGCTAG
CGTCCACATGAGCTACACACGCGAAGCAGATTCGATTGCGACGCACTTTACGCGCCACGGGCTCCACCGCAAACTTCCGCGAACACTCACGACAGACTCG
GTGAGCGCAGAGCTGGCAGAATCGTTGCGAGCGCAGCAACCCGAAAGCTTTAAGACACACCGTGCATCTGTTGTCTTGATCTGCGTCTGGAGCCACGGGC
ATGTGCAGCATTGGCTGGTATCCCaatcgacgacggcgaaCGAGTTGTTCAAACGACgtcgttgcagcagccagtaagttcaccacgtacttggcctcGA
CATTGGCGCTCTGTGGTGCGCAGTGTcgtgaagaaccagaaggTTCTTTCCCCCAGAACCGTGAACGAGCTCGATATACGTTGgatactggagctggtgg
actgGTGACGTACGCAGTCATGACAATTCGTGTTTGGTGGCCActcaagctgctgtacgaacTCGCTAGGTGATAGCCAGCGGAAATATGCTCCATGTCG
CCTTGAATCGCCTGGTTGGCAGCGCGTTCGTTTCTGCGGCGGGTGAATTTGTCGTGCATGGGCTTGGGCAAGGTCTTCATGGTGTAGAAAGCTTCGTTCG
TGTCGGGGCAGTACTGCGAGTACGCAGCGAAGCAAAGTCTCTGTCGACGACTCGTGTGTTTAGCTGCTGTCATGGGGTTCAACGACCGTCGAGAGCGCAA
AACCACCGACTGCAGCGCGACCCAGCCAGGCTGCGAGAGATCGTTGAGGTCGTCGTCTTCCCAGCAAGCGGCGTGGTCCATCGCCAGCACAGTGTGTAGA
TTCTTGCGGAACTCGCGCGACACTAACAAGTCTCCGCTTTTGTATTTCCTGGCACCGAAAAGCGCGCCCATGCTGCCATCAAACTGCAGTGAGTCGCGGC
TGAACAGCATCGTCATGGCCTCATCCAGCctgcagctcagcgtcaCTTGGGCGGAGACCGCGtagacgacgctgctgtcattCAGTGGCCACTGCAACAG
CTCTCGTGCTCGCACTTCGGACTGCGTGTGTTCCCCCAGAAAGGCATCGCGACTGTAGATGGAGCCGCGAGGCTCGACCATTGAATGGCGAACATCGGAG
ACTCGAGTATTGCCGCGAAACCAAGTGGGGGCGTCGCTTTTGGTCGATGGGAGCTTGGCTCGATCGAATTCGCTGATCTCTGCcccatgctgctgctttt
tgaCGACCCAGCATGGCGCTTGTTGTCGGTTTGATGATGTCATTCTTCGGATACTACTCCGAAGACTGTCTTTGCGGTATTCCATCACCGATCGAAGCTT
TGGGATGACGCTCGCTGCGGTGACGAACAGCTCACGGTCGGTCACGATAGCGTTGATAGACGACGCGGACAGCAGAGCGTTGCGTGCGGACACGGGTGAA
GCGGcactgttgttgctgctctggaaGTCGCAGCTTCGGATGCTGCCTCGGCAACTGCTACCGATGTAGCTGTCCGTCATTGAGGCTGGTTGtgggtgct
gctgcttgggtcTCTGCAAGTTGAGGAGTGAGAACGACTACGCCGCTCAGCGCAATGTTGACGCAGCCATTTACCTCGCCAGGAGCTCAGCAGGATGCCA
GTGCCGGAGCAGGGAAGGTGTCGACAGCACCGGATGCCTGGCGCTCTTGCTGGCTCCATGATGTTAGCCTGACCGCTTTTCACGAATGGCTGACTGGTGC
ACGATCTCGTAAGCGACGAGGCACCACCAAGTCACACCTTTTTCGATGGCCCCCTGGGCAGTGGAAATTCTGAGCATTGCTGGAGTTTCGATGACACttt
gttgaagctgttttTCGATCTGTGAAGACCGCATagttgccactgctcgccAGTCATcacgctacatgtagaacaaATTACTTTAGATTTGATCCGAAAC
TGGAGAGCTGTACGATGCATTCCTTACCCATTCCCATTCGAAAGCTGGAAAGTTAGAGCGAGTGGATTTCCACAGGTGCGGGCACTATTTAGCTCTGGTG
CAGCGGTGGTTACGCCGTGCGCGTCATGTGtagcagtggagacgaccaCCAGTGTCCACGTTCGTCGTACTCAACTGCTTCGGGTGCCTTTAACATATCT
GGCGTGTTGCACGCAAGCCCCCGTATCTCCATTTCGGTGCTTCGGTGTTGCGCATTTTTCGCGCGATCGTCGCCTCCGAACCCCatcacgttgaagttgt
ttgGTGCCAAACCGGCTAACAGATGACTGGCCTGGCGACATCGACTTCTGCACAACCCACATGCGATTCAGTCCCACACACCCAGAAGAACTACAAAATG
TAAGGAAAAATCACCTTGTACTTAAGAAATAACGGAGACAACAAACTTTCCAAATGCTATGCGCGGTTCAAGCTTGTTCCTCTACAGCTCGTCGtgctcg
tcatcttcatcgtcgtcatcgtaGTCGTCCTCGCCCTCCGGGCCAGCACCGCCCTGGTAGACCTTCGACATGATGGGGTTGACAAGCTTCTCgacctcct
tctgcttcgccTCGAAGTCCTCCTTGTCGGCCTCCTGGTTATCCTCAAGCCAGTCCATGGCATCCTGCACAGCAGTGAGGACCgtgtccttgtcgtcctc
gtcgatcttgtccTCAAGCTTCTCCTCGACGTTGTTCTTCAGGCTGTACAGGTAGCCCTCCAGAGCGTTACGGCCATCAATGCGgtccttgaccttcttg
tcctcgtcggCAAACTCAGCAGCCTCCTGGACCATGCggtcgatctcctcctggGACAGACGACCCTTCTCGGCAGTGATCGTGATCGTCTCAGCCTTGC
CCGTGCCCTTGTCCTCGGCGGACACCTGCAGGATGCCGTTGGCGTCGATCTCGAATGTCACTTCAATCTGGGGCACACCACGCGGGGCGGGGGGTAGGCC
AGTAAGCTCGAACTTACCCAGAAGACGGTTGTCCTTGGTCATAGCACGCTCACCCTCGAACACCTGGATCAGCACAGCGGGCTGGTTGTCCTGGTACGTG
GAGAAAGTCTGCGACTTCTTGGTCGGGATCACAGTGTTACGGTTGATCAGCTTGGTCATGACGCCGCCCACAGTCTCAATACCCTGGGACAGAGGCACCA
CGTCAATCAGAAGCACGTCCTTGGTCAGGTCGTCCTGCTCACCGCCCAAGATACCGCcctgcactgcagcgccgtaAGCGACGGCCTCATCGGGGTTCAC
ACCACGCGAGGGCTCCTTGCCGTTGAAGTAGTCCTtgatcagctgctgcaccttaGGGATACGGGTAGAACCGCCCACCAGCACAatctcgtccacctcc
gACTTCTTGAGGTCGGCGTCCTTCATCACCTTCTCGACGGGGCCGAGGGTCTTCTTGAACAGGTCctcgttgagcttctcgaaaCGGGCACGGCTCAGAG
ACTCCGTGAAGTCCTCACCGTCCAGAAGAGACTCAATCTCAAGACGAGCCTGGGCCTGGGCCGACAGGGCACGCTTAACACGCTCAGCCTCACgacggag
cttctgcagggCACGCTTGTCCGACGCGACGTCGaggttcttgtccttcttccacttcttgaTGAAGTACTGCATGATACGCTGGTCAAAGTCCTCACCG
CCCAAGTGGGTGTCACCGTTGGTGGCCAGGACCTCGAACACACCGCCATcaatggccagcagcgtcacaTCAAAAGTACCGCCGCCCAGGTCGAAgacca
gcacgttcttctcgcccTGTGCCTTCTTGTCAATACCGTAggcaatggcagcagccgTGGGCTCGTTAATGATACGCTGCACAGTGAGACCGGCAATGGT
ACCGGCGTCCTTGGTAGCCTGACGCTGGGCGTCGTTGAAGTAGGCGGGCACCGTCACGACGGCGTCAAACACTTCACGGCCAATGTAGCCCTCCGAGATC
TGTTTCATCTTGGTGAGCACCATAGCCGACACTTCCTCGGGGGCGAACTGGCGCTTCTCGCCCTTGACATCCACCTCGATGAAAGGCTTGCCTTCCTTGT
TGATGATCTCGtacggcagcagcttcttgtcggcCTGCACCGACTTGTCACTGTACTTGCGGCCAATGAGACGCTTGACATCGAACAACGTCTTCTCCGG
GTTGATCGTGGCCTGGTTCTTGGCTCCGTCACCAATCAGACGCTCGTCGTTCGAGTCCCAGGCGACGTACGAGGGCGTGATACGGTTTCCCTggtcgttg
gcgatgatctccaccttctgGTCCTTGTAAATGCCCACGCACGAGTAGGTCGTGCCCAGGTCAATGCCGATCACGGGGCCGCGAGGACCCTTGGTGTCGT
CGGCCACCACGGCGCCGGCAAAGGCGGCCGCCGCCATGAGGATAATCTTCGTCAGGTTCATCCTTAGCTTCTCGCTGCTAAAACGATAATGACAGGCTGG
AACGCGTGGAAGTCAAAGATCGGAGGGTAGCTTGTACGCTTCGAATACAAGGCAGTATAGTCTTTGCAAGTGTAATGCAGTGCTGACGTGGCCCAGCGCG
GGTTTCGAGAAAATGGGTCTTCTAGAAACCCGCTTAGAACGGACTGCATGTTTGTATGGCACATACAGAAAACAAGTCAACGATTGCCACGCGTCGGTGA
TGCCCGACTAAGTGCGAAGATATGCCACGTACAGGTACAGGTATGTACGTGTTCAATAGACGAACAGATCGAGAATGCTCGTGTGGTGCATTGCACTACA
GTATACCGTTACCCATAGCAGTTATCCATGATAGCAGTTATTCATACAGTTAGTGGCTGCTGTAGTTGCGATGGTGGAGGAGAAAGGTGCGTGCTCTGCT
GCAATATCCTGTCTGGATCGTACTTAGCTGGGGGCAACTCTCCACGTGGCATGAGGACAACAACCCGACTGCACGTGGCGGTGATTTGCACTGCGTTTGA
GCAAGCCTTGCGGTGATGCAGCATCAAAGGTTGAGGCATCGACAAGAGCAAGTTGCCTGCAATGCGCTAGTCGAACGGTAGAAAACGTGGAGAGAGGCTA
GCGCAGTCGAGGAAGCATCTTACGAACAGCA