Description :
From Genome Similarity Track
Location :
contig_21:659951- 661127
Transcript NameFunction/comments
g4920.t1RAW40286.1 hypothetical protein PC110_g3516 [Phytophthora cactorum

Sequence
1176 bases(100 bases per row)
ACGAGAGTGAGGTAGTTTACCATCTCTTCCTTCGTGTGGTAGAGCGGCAGGTCGATACGGTTGAAGCACGTGTGGCCCTTTGGCATGAGGCCCGTGGGCG
GGGCCCCACGCTGCACGAACTGGATGGTAAAACGACGGACACGTCCATCACTGCTCATAAGTGCCTTGAAACCCTGAACAGGGACGCGAGACGTGCCGGT
CGCGAACTGCAGCAAACGGGCGCGCTCCTCACTGGTGAACTCTGCCATGGACTCCCAGAACCATTTCAGCACTCGGTGCTCGACAGGAGTCGGCTTTTCC
AGCTTTATCCAGCGGACCTCACTGTGCGTGTGCCAGTCGTTCACGTCTAGCTCTGGCACACCAGAGAGCAACAGATCGAACTCCTGATAGTCGAACACCG
TGATCAGGAACTGTGGCATGACATCGTAGAAGCCCATCAGCAGCGCACCAAGCTGTTCCGAGATACTCTCAAACATGTAGTGTTTCAGTAGCAGCTCCAG
GTACTCCTTTTTGTTGTCGTCCGTGACATCGCGATTAGCACCACCTGGAACCAGCTCCATCGTGTGTGACTTGCCCTCCGAAGTGATCACCTGCACCGTG
AAATCGATAGCCAACAACTCAGCGTGATCGTTCTGTTTCATCCACATCGCATTCTTGTACAGGTCTTCGTCGAGGAACTCCAAGTCCGAGAACGAAATGG
GCACGCCAAGAATGTGCTTAATGAGCGGAAGCGCCAGCGACATCTTCATGTTGTAACCCTCAATCAGCGCCTTGGCCAGCAAACGGCCTATAAATTCGTA
GTACTCCAGGTGGTTCGGCACCTTTGAGGCCGACGCTGGGTTGATCCAGTAGCCCATGTTTTCTCCCTTCGTGGCGATGAAGAGACCGAAGTCATCGTTA
AAGAGCGAGTCACTCAGAATTTCATACCACTCACGAATCAAGCCACCAGCATCAAGTCCAGGCTCGTTCTCGAAGTAGATGCGGAGACGCTCCCAGAAAC
GACTGGGCGGACACTTGAGCATCTGCTCGAGCGAGTCGCTCACCACGTGCTCCCGTCTTACGACGAACTGGATGTGACCCTCCTCATAGCTACGCCAGCG
CTTCTGCACCTGCTCAAGGAACCAGCGGTTCTTGTCGTGGAAAGTCAATGAAGCAATTTCTTCCAGGTCGTCCTCA