Description :
From Genome Similarity Track
Location :
Scaffold_467:6599- 8612
Transcript NameFunction/comments
Physo_145087hypothetical protein

Sequence
2013 bases(100 bases per row)
GTACTCCTTCGAGTACGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGCCGCTCAGCTTGGAGGCACCCGTGTCGCCACCAACCGAGAAGAGG
AAGTCGCCAGAGTCATCTTCGACCTGCGCGACGTTCGCTCGTTGCGGCCTCTGCCGCTCCCCGTTCTCGCGGATCCGCACCGGACACTTGGCGATCCAAT
GTCCGTGCTCGCCGCAGTAGTGACAGGCGCTCGTCCTCTGCGCTTGCGCCTGCCGTCCCTTGCGCTTTCCGTTGTCGCTTGTCATGAACGCTTGACCTTG
AGCGTGCGCGGTTCCGTCAGCACCGCCACCTTGTTCCTTGCGCTTCATGTCCTCGTGCAGGAGCCGAGACGTCACGAGCTCCCACGTCAGCGTGTCGGAA
CGCGATTCCAACGCCGTGATGAGTAACTGGTACGACTCGCTCAGACTGGCAAGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCGACCGCGT
CGAGCTGTTCCGCCAGCGTCTTGAGCTTGTTAATGTGCTCCAGCACATCATCACCTTCGTCCATCGTTGTCGTGAAGAACCGTCGACGAAGAAAGAGCTT
GTTCGCCAGGCTCTTCTTCTCGAAGTGTCCCTCGAGTCTTGACCATGCATCATGCGCGTCCTTCGCCGACCGCACCAGCGGCAGCTGCGAGTCCTCCAAC
GCGAGACAGACGATCGCCAGCGCCTTGCGCGACTTCTTGCGAAACGTCGCTTGGTCCGCCGCGGTCGTGCACTGCTCGAGCTTCACTTCCCCACTCGTCA
CTTCCCACAGTTCGCGCTCCTCCAGCACCATCTGCATCTTGAACTTCCATGTGTGGAAGTTGGTTCCGTCGAACTTGTTGATGCGGGCGGTCGCGGTCGG
GGCGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGTCAGGGAAGACGGGGCTTGGGCTCATAACCAAAAGGAAGAGCACTTGAGCAGTAGTTGGCAAA
ATGCAAAGTGATTCGATTCAGGTCCTTAGTTCGCAACCGCGTGCTACCTCTAAGCCTGCTACTGGATACCTCTTACTGGATACACCCTACTGGATTCTCT
ACTGGATACACAGTTACCTTATCCAATCAGAGAACGCCACGTCGATGCCCATCTTGTACCCACAATCTTGGCGTAATCACCGTGACGTAATCATCGTCCC
GTAATCACCTGAATGATTTCGGTACCACACAGTGAAGGTCACGCCGACCTCACTGATGACGCGTTCGCGTCACACGGTCGCTTGGCGGGGCGTCGTCACA
TCAGTCTTGACAACAGGCATTTCCATTGGCCGGGCTTGTACAAGAGTGTTCAGCGCTACGTTGGGAGATGTGTAGACTGAGTCCGAGAAGGGCAGACCTA
CAATCAGGGGCAAGTCGCCGGGGAACATCGTGGCAACTCATCCTTTCCAGGCGATCGCCATGGACCATATCCCTTCGCTACCAGCATCCTACAAGAGCAA
CACGGAGTTGCTGGTATGGGTCGACCTTTTCACAGGTTTTGTGATTGTGAAAGCAAATGCGTCCCGATCGGCTCAAACAGTGGCTGAAGCGCGTGTTCAG
ACGATTCGGAGCGAGTGAGGCCATCCGACACGACAGGGAGCCGGGTTTCATGTCTGACTTTTTCAGGGCGTTCAACAAGCTGATGGGACAACGCCAACGG
GCTACGCTTGCGTAACGACCTCAAGCCATTGGAGCAGCCGAGCGGATGGTACAGACCGTGACGAGAGCCATCATGATGTACATTGAAGATGTGGACCAAC
GTGACTGGGATGCTTATGCGGAGAGGTTGACTTTTGCCCTGAATACGGCTCAAGATCGAACTCGGGGCGCGACCCCGTTCTACCTCGCGCATGGCTGAGA
TCCACGCACGACGATTGAAGCAGCCTTGTCCGTGGGGAGCACAAGTCGCCAAGACGGAGATGCCCGTCGGTGGGGTATGAGGATTCAACGCCACTACAAA
AAGGCTCGTACCC