Description :
From Genome Similarity Track
Location :
Scaffold_27:65981- 68334
Transcript NameFunction/comments
Phyci_220147Hypothetical protein
Phyci_5595Hypothetical protein

Sequence
2353 bases(100 bases per row)
CTAGGCCCAGCAGTGtcagtctgtgcagatactcaagcgtcgactcgtcggatcgcttcctcgcgtggtagtactgtctcgcgagggacacacgaaggcc
acagtactcgacactgaagtccttgagcagctccttccagttgctgcgcgtcgagcgaccaagttgctggtaccaattgcgagccggcccagtatgtagc
ccacagaagacgatgcacttcttgctgtctggagcctgatcacggatgaacgcagactcgactttactgagccagactcgagagcgatcttcgtcgatat
ctttccaggagaacgctttcagctctgcgatcgtagacattcggactcgaaggatcGCCGATGCACTGGGTGCTGATCCAGATGTTGCTTCAGCGGATAC
CACGATAGCACGTCAGGGTGCAACGATGCTCAAGTCTTCAGGGTCATACTCATTCGGCGAATCGTGCAGCGGTCCGACCGATTCCATCTCGACTTCATGA
ACACCAGAGATCCCGAGCTGGTTGGTCAACGGAGAAGTCAATGCAGCAGCTTGCTACTCCTTCAAGAACCGCTCCATCGCAGAGTAAAAAATGACTGCAT
CCGTTCACGGCTGCGGAGATCTTCGAGACGAAGAGGCAGTTGTTGCGCTTTCACTTTCCGATCCTTGATCGTGGCAGCTCCAGACGGTCCAAGCGTCATC
CGTCCGATACCGACCGAAGCATCCGATCCAAGGTCCGACACCACAGATCCTCGTTCTGATTCGTTCGCGGACACGAACAGCGACGGTTCTGTGTGAGAGC
CCTCGGTGGCTCGCGGCATACCGAGATCTGGAATAGTCGGTTGTGGGGAAGCACCAACCAGCGGAGACAGCAGCTTGAACAGCAACGCGGACGCCGACTG
GATCGTGACCCCACTCAGATCAAACAGCTCGCTTGCGTCGAATGCGCTGGTCGCGATGTTCGCGTTCTTCAGCATCGCATCAATCGGCGAATCGCATCCA
TCTGGTTCGTGGCTGGGACTGGGGCCGCTACGGGACCCTGCAGATCTCCGATCAGCTGTGGCTTCAGTACTTTCATCGTGGGATCTTTTGCCAGGAATAC
GTTGAACTCTTTCTGGTAGAAGATCTTCTGCAGCTGATCTTCGGTCCACGCCTTGATTTCGCAGGTCTCCTCCGCGTTCGGTGCCTTCAGCTTCATATTC
TTGGTGGCCTTTACCTTCGTGGTAGTCTTCTTCTTCTTCTTCGAGGGGACATGCGGGGCGGGGAGAgtggttgtgggcgaaggtcttcggttttcaccga
tgagtcttcatccagcggatcacgatacacatcgtgttccgcggggcccacggaggggcctaagggaggagggtgaggcttcttttccaggtccatcgct
gaaccttcatcctcatcccgtcagagttcctcccagcactttgacgatcggaaatcctttactcttcagattcgacgacgtcgattcacctttcgtcgac
gcgccgatccccggttcaactttgatattgacatcttcttgggactcgcggtgaaaaccagggtcatcagaagatccaggcacgcccaccattgtagcgt
agtggtttcgcgaagactacgacgcggcacgcactcacacacagaggcgcccagattaccgactaacggagcgggtaccacgcttgccgtgaagggcctg
aagtcttgctcaccttgtgtacccgtcggtgtgggcggttacgctcttccaaggtgactctggaagatgtcgggcttgatcttgggttgagcaggtgtgg
acggcacttgggggattcggtttgacgctgtcgtggaaactcttcacacagcagtcgttagggtgtagatcttgtcttgaataaaattgatctacgcggg
gttgcacattgggtgtgttccaatcattcttgttccgtttcgggcttgaccgcctccttctggcgggatctttagcggtggagagatgtgtgcagcccgg
ccaagctatccggggacttgggtgccttctccttgcgtgacttagcgttccttggtcgtcggaggaggccaatctacctcccagccccggaatatagaag
gcgccggtgtcttgcaaggaacatccctctccgtgttactgggtaaattgccaagtctaaaactacactgttcttcgcttttctctgccgtctcctaaag
tacgccacgtgtcagcggttcccaacctcacatttgccaaactggctccctggtcagagttaatgcgggtgtatcatttttctggtaccggtcgatctgc
atcagtatctgtacccatatcgaaatgttcgtgtcaatctgaggATCCGGTCG