Description :
From Genome Similarity Track
Location :
contig_28:6596- 11557
Transcript NameFunction/comments
g6867.t1hypothetical protein
g6868.t1XP_008899719.1 hypothetical protein PPTG_07304 [Phytophthora parasitica INRA-310
g6869.t1hypothetical protein
g6870.t1RAW30665.1 hypothetical protein PC110_g12978 [Phytophthora cactorum

Sequence
4961 bases(100 bases per row)
AACAGTTCCAGACATCACCTGAACGACAAAACCCACCCTACCACTCCCGGTCTCAACCTCGCTCTAAATTCCGAGGTTGAAGTTCGCTCTGTAACTCTTA
CTGAATAAATGCTGAATTTTTGTCCCCACGACTGGAAGTACGAAGAAATCACAAATTCTGTTTTTAAATTTTCAAAATAACCACATTGAAGCGGCATTGC
ACCATCTTGGTCGGAAATTCCTCTCGTTCAAAATTAGCGAAGAAAAACAAGCTTTTTAGAAATGTCAACATTTGTATCTCAAGCAACTACATCTGCTTCG
GTAGCAATGCGACTTCTATCGACCAAATCTAGGCTCTCTACTTACAAGTTTTCTATGAGAAACCCGTCAACGCCAGAGCCATACGCCGTGTTGATGCTGT
AGCCAGCGATAAGCACTACTGCTGCTATAACCGAGACCAAGTTGCCGATGAGTCCGCAAATGGTGGCGGCACCGATCAACACGAGCCAGAACATAACCAG
CACGGCCATCGCAGGCACTTGATCCTGCTGAAAAAGCGGTTTTGCTCCGTCCGGAAGCTTACCATTCGACTCGTAAAACGCCTTCAGCAAAGACTCCTTG
CGTTCAAAGCGCTTCTCCACCCACGTCGCAAGCTCGCTCTCGCTTTTGTCGCGCAGCGACGAAATGTCCACACGCTCGAGGTAGAAGTGGATCATTCGCG
GCACACGACCAGTTAGCAGCGACGTCTCCGATGGACGTTCGTTTGCGGCGTAGTCCACGTAGAACATGGTAACATCGTATACAGCGGTGAGTTGAGAGCG
CAGTAGCGGAAACATAAATGTCCAGCCTGTCGTACGCGGGTACAGCGAGTACTGACGTGGCGGCAGTCCGTTCTTCTCGGCGAATACAGCACTCTTATCA
AGGTTACTCTCGCTCAGATCCGTACCTTCTGGGAAGAGGAGGTATGAAGCCTCCGGTTCTGCCGACGTGAGGAACGGCAGCAACTTGCGCAGGTTCACTT
GGTCATCAGCCCAGCGGCGTTGCTGTAGAGAGCAGACCCCACGTTAGCGCCTCACTCTCATTGCTTCCTAAAGTGTAGATGTTACCAGAAATATGAAGAT
GAAGTGCTGCATGGCCCAGCCGAAGATGGGGATTTTGCGCAGAGGGGCCTTGAGGACGATACGCAACTGGTGCAGCGTACGCGTTCGCCAGGCCACACTC
CACAGCAGCATCCAGTCGATGCGAGTGCGGTGGTTCGACAACCACAGTGCGCGGTCTTGCGGCATGTCGCTCTCGTGAGCTTTGGTCTCGGCGTCGCCGT
AGACCTGCACCTGGATGCCAAACAGTTTCTCTGGCAGAAGTCATAGTGAGCGTCTCGCACTGCCAACGGCTTCTATAATACTTGGAAGTGGCAGATCCAC
GCACCCAGAAGCAGCACGACTTGACCCATCCACGCCCATTGTCTGCTCCAATAAACACAACAACAGCTCATTGAGTAACAAACCTCCCGTCATCCTTTGT
TGGGATTCCACCGACGCACATGCAGCGAGTGACGCGGCGGTAGAAGCGTTTGGTCTGCAGAAACGCCGGCAGAGGCAGGGCCGCGAGCACGAAGCACGGG
GTCAGCACCCACGCTAGGGCTGTCCAGCCCGTGAGCGCCAGCGATACCAGGAACACGACACCCACAACGGACACTCGCATGGTCTCCGTTGCTAATTCTC
AATTGATACCATAAGCATCTGATCGTAAGTTATAGGCTTATCTCCTAAGATATGTGATACATATATTTATACAGCCTTAGGAGATATGTTACACTGTATA
TCCACTCGCCTTCTTCAAGATTCATTTTAGCTTTGGAGAGGCAGAAAATGACGACGAGGGAGGAAGCGGAGCGCGACGTGAAGCTCCTCGTGAGCTTCGT
GGCCATGGTCTTCGTGGGACTCGGCAACAAGAGTGCGTGCTAGTCTCTAATCTGCACAATAAGGTTCTTGTACGGCTTAAAATCTCCCAACTGACGCACT
GTTCTCCGTCCTGGATGAATCATTCTCTGCTCAGTCTTCCAGAAGTGAGTTTTGCTACACTTGGGGTGCAGCTTTACTTGTGATTCGTATACTTAACCGA
TGACTTTGATAGACTGCAGACCATCCCGATGCACAACTACCCGACGTTCCTCAACCTGCTCACCACGTTCGTCTACGTACGTGCGGCCTTCGAGTGCATG
CTGTACGCTTTACTAACTGGGTGTTGGATACACTGCAGATCCCCATCAGCTTCGCGTACATCCTACCGATGATAAAGTATGGTAGTGCCATCACGTGGGA
CCAACGCAGCATCCCGAAGCGGAAATTCGCCGTTATGGGAGGACTCGACTCAGTCGCCGGCATCCTGCAAGTGTTTGCAGCCACCTATCTGGGTGGATCG
CTCATCATCTTGCTTGGACAGGCTGCGATCCCCATTTCGATGTTGATCTCCAGTCTGTTGCTGAAAGCCAAGTACTCGGGCTACCAGTATGTTGGAGCTA
TGGTCGTGACGCTGGGCTTGCTGATTGTACTGGGGTCGGGCGACTCTGGCAGCAGCAGCGGCACCAACCCGCACCTCATTGTGCTGTGGTCTGTTGTCAT
GATTTTCAGCTGTGTCCCCATGTGCCTGTCCAGTGTATATAAGGAGAAGACTCTGGGGGAGGCAGAGCTTGATGCGGTCTATCTGAATGGCTGGATCGCA
GTGTTCCAGTTTCTGTGTGCTATTCCACTGACGTTCCCGGCAGCAATGGTTGGCGACCACCCAGTCACGCCGAGTGAACTCCCGGAGAATATGTATGACG
GCTTGATGTGCTACTTGGGGCAGAACACCATCACTGAAGGCGCGCACAAGGATGACTGCGAGAAAGCGACCATCTACGTGACGGCCTATTTGCTGTTCAA
CGTGGCGTACAACCTGCTCATCATCTTGATCCTCAAATTCGGCAGCGCCAACATCCTTTGGCTGGTAAGATCCTGTTGACATTTGGCCATTTGATCACAT
GAAGTAGCTTTCTCTGACCGTTCTTGTGTTGAACAGGCCATGACCATTATGGTTCCACTGGGCAACGTCGCGTTTACGTTTCCGTTTATGCCGGAGCACC
AGCCTCTGCACACAAAGGACATTGCAGGCTTGCTGTTCATCATGCTGGGGCTGTTCGTGTACCGCTTCCTGGAGGAACTTATGGACTCTTGGAACAAGCG
GAAACCCGTGTACCCGGACGAGAAGGGCCCGGCCGTAGACGAACTCAAGCGGGCGCTCATCAGCAGCGACAGCGACAACAGCGATGATCAAGAAGTCTAA
GTAAACGGCATACAGTTACGGGTGCACTTTGCAGTGCCCGCCATTGTTAACGAATGAAAATCTATGAGACGTGTTACGTGTGCTAGTACTCGAAGCCCAC
TGCATCGTGCTGGTACAACTTACTTGACTTCAACCCGTCAAAGTGCTGTACGCACACATATAGGGGTTAGGTGTTATGTACACCACACGCTCCACGGATG
GCTATCGCTTATCGACCGCAGAACCGGGAAGACCACCACTGCACATCGCTGAGCATGCTGGCCGCCGCCACCAAGAGCTTCGTGCGCGCCGCGGGCGCCG
CCGGGTCGCGCCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTCTCTTCTCCGCAGAAGCTTCGCCCGCCGCGCCCGAGCAGCCCAAGCGCGCCAAGCTCAA
GATCCCGACCAAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGAGGCGGAGGCCGTGGCCAAGGCCGCCGAGGGAAAGGACATTGACAACTTCAAGCCCGGC
GATTCGGTGGAGGTGCAGTACCTGCTGAGTCGCACGGGCGCCCGAGTGCAGCGGGTCAAGGGCGTGGTGCTGGCGCGGCGAAACCGCGGCACGGGCAGCT
CGTTCGTCATCCGCAACGTGAGTTTCGATGCGTTTACGCTGCAGCGGTGAGAGGCTAATTATCATTTTATTGTTTGTGACAGCACATTGGCGGCTACGGC
TACGAGCAGAAGATCTTCCTGCATTCGCCGCTGCTGCAGAGCGTCAAGGTGCTGCAGGAGGCGTTCATCCACAAGGGCAAGAAGCGCGTGCGTCGTGCAA
AGCTCTTCTATCTGCGTGAGAAGGCGCCCAGCTTCACCACCGTCTAGGCGGTGCGGCTACGACAGACTCGGCGGAACCAGCAACGAAGTCGTCACAGCTA
CCAGTCGTGCAGATGTCTGGATGGAGGTAGCAGCGCTGCTGGTTAGATGTAAGCGGCACGGGTAGGGGGGTGGTAGCAGCACTTAACACTAGAGAAGAAA
AACGATTCACAGACCACAAGCTACAGACAGGAACAGGGTCGTCTGTTATCGGCAAAGGGCAGCTCGTTTAGTCAAGCCGCTGCGACTGGGGCAGCAGCTA
GTATCTTGGCGCTCCCTCTATCTGCGTTTCTTCTTCTTGGACTTGCGAATGCCAGAGCCGCTGGACACCACGACGGCAGCGGGCTTGTCCGACTCGGCCT
TGCGAGCAGCACGAGCGGCTGCATCCAGCTTGAGGGCGTCCTTCTCCGTGCCCATGCCAGCACCCTGCGCACCGACAAAGCGGTTGCGGCCACGACGGCC
GCGCTTGCCGTGAGAGCGCTGCTTGCGTGGAATCCAGCGCTCCGGGTCCGGGTTCACCAGCCCAATAGACGCGTTGTAGTCCGGACGAGCGCGCAGGTTG
GCCAAATGAGTCTCTCGACGCTTAGCGCGCTTGCGAGCGATGCCCTCCGGGCTCTTCGCCGCACGTTTGCGCCTGTAGGCAAAAAGTGAGGTCAACATCT
ATGTAGAGAAACAAGCTAGCAACACGGTGCCCAATACGTACTCGTTCTTCTTGTCACCAGTGTCGGCAAACTTGGCGGCCAAGCGGTTCGAGCGCGGGGC
CTGTTTCTCCAATTCACTAGGGTCAACGCCGCTCTCCTCAACGACCGGCAGCATAGCGCAC