Description :
From Genome Similarity Track
Location :
contig_28:6595- 11512
Transcript NameFunction/comments
g6560.t1RAW30662.1 hypothetical protein PC110_g12982 [Phytophthora cactorum
g6561.t1XP_008899719.1 hypothetical protein PPTG_07304 [Phytophthora parasitica INRA-310
g6562.t1hypothetical protein
g6563.t1RAW30665.1 hypothetical protein PC110_g12978 [Phytophthora cactorum

Sequence
4917 bases(100 bases per row)
CAACAGTTCCAGACATCACCTGAACGACAAAACCCACCCTACCACTCCCGGTCTCAACCTCGCTCTAAATTCCGAGGTTGAAGTTCGCTCTGTAACTCTT
ACTGAATAAATGCTGAATTTTTGTCCCCACGACTGGAAGTACGAAGAAATCACAAATTCTGTTTTTAAATTTTCAAAATAACCACATTGAAGCGGCATTG
CACCATCTTGGTCGGAAATTCCTCTCGTTCAAAATTAGCGGAGAAAAACAAGCTTTTTAGAAATGTCAACATTTGTATCTCAAGCAACTACATCTGCTTC
GGTAGCAATGCGACTTCTATCGACCAAATCTAGGCTCTCTACTTACAAGTTTTCTATGAGAAACCCGTCAACGCCAGAGCCATACGCCGTGTTGATGCTG
TAGCCAGCGATAAGCACTACTGCTGCTATAACCGAGACCAAGTTGCCGATGAGTCCGCAAATGGTGGCGGCACCGATCAACACGAGCCAGAACATAACCA
GCACGGCCATCGCAGGCACTTGATCCTGCTGAAAAAGCGGTTTTGCTCCGTCCGGAAGCTTACCATTCGACTCGTAAAACGCCTTCAGCAAAGACTCCTT
GCGTTCAAAGCGCTTCTCCACCCACGTCGCAAGCTCGCTCTCGCTTTTGTCGCGCAGCGACGAAATGTCCACACGCTCGAGGTAGAAGTGGATCATTCGC
GGCACACGACCAGTTAGCAGCGACGTCTCCGATGGACGTTCGTTTGCGGCGTAGTCCACGTAGAACATGGTAACATCGTATACAGCGGTGAGTTGAGAGC
GCAGTAGCGGAAACATAAATGTCCAGCCTGTCGTACGCGGGTACAGCGAGTACTGACGTGGCGGCAGTCCGTTCTTCTCGGCGAATACAGCACTCTTATC
AAGGTTACTCTTGCTCAGATCCGTACCTTCTGGGAAGAGGAGGTATGAAGCCTCCGGTTCTGCCGACGTGAGGAACGGCAGCAACTTGCGCAGGTTCACT
TGGTCATCAGCCCAGCGGCGTTGCTGTAGAGAGCAGACCCCACGTTAGCGCCTCACTCTCATTGCTTCCTAAAGTGTAGATGTTACCAGAAATATGAAGA
TGAAGTGCTGCATGGCCCAGCCGAAGATGGGGATTTTGCGCAGAGGGGCCTTGAGGACGATACGCAACTGGTGCAGCGTACGCGTTCGCCAGGCCACACT
CCACAGCAGCATCCAGTCGATGCGAGTGCGGTGGTTCGACAACCACAGTGCGCGGTCTTGCGGCATGTCGCTCTCGTGAGCTTTGGTCTCGGCGTCGCCG
TAGACCTGCACCTGGATGCCAAACAGTTTCTCTGGCAGAAGTCATAGTGAGCGTCTCGCACTGCCAACGGCTTCTATAATACTTGGAAGTGGCAGATCCA
CGCACCCAGAAGCAGCACGACTTGACCCATCCACGCCCATTGTCTGCTCCAATAAACACAACAACAGCTCATTGAGTAACAAACCTCCCGTCATCCTTTG
TTGGGATTCCACCGACGCACATGCAGCGAGTGACGCGGCGGTAGAAGCGTTTGGTCTGCAGAAACGCCGGCAGAGGCAGGGCCGCGAGCACGAAGCACGG
GGTCAGCACCCACGCTAGGGCTGTCCAGCCCGTGAGCGCCAGCGATACCAGGAACACGACACCCACAACGGACACTCGCATGGTCTCCGTTGCTAATTCT
CAATTGATACCATAAGCATCTGATCGTAAGTTATAGGCTTATCTCCTAAGATATGTGATACATATATTTATACAGCCTTAGGAGATATGTTACACTGTAT
ATCCACTCGCCTTCTTCAAGATTCATTTTAGCTTTGGAGAGGCAGAAAATGACGACGAGGGAGGAAGCGGAGCGCGACGTGAAGCTCCTCGTGAGCTTCG
TGGCCATGGTCTTCGTGGGACTCGGCAACAAGAGTGCGTGCTAGTCTCTAATCTGCACAATAAGGTTCTTGTACGGCTTAAAATCTCCCAACTGACGCAC
TGTTCTCCGTCCTGGATGAATCATTCTCTGCTCAGTCTTCCAGAAGTGAGTTTTGCTACACTTGGGGTGCAGCTTTACTTGTGATTCGTATACTTAACCG
ATGACTTTGATAGACTGCAGACCATCCCGATGCACAACTACCCGACGTTCCTCAACCTGCTCACCACGTTCGTCTACGTACGTGCGGCCTTCGAGTGCAT
GCTGTACGCTTTACTAACTGGGTGTTGGATACACTGCAGATCCCCATCAGCTTCGCGTACATCCTACCGATGATAAAGTATGGTAGTGCCATCACGTGGG
ACCAACGCAGCATCCCGAAGCGGAAATTCGCCGTTATGGGAGGACTCGACTCAGTCGCCGGCATCCTGCAAGTGTTTGCAGCCACCTATCTGGGTGGATC
GCTCATCATCTTGCTTGGACAGGCTGCGATCCCCATTTCGATGTTGATCTCCAGTCTGTTGCTGAAAGCCAAGTACTCGGGCTACCAGTATGTTGGAGCT
ATGGTCGTGACGCTGGGCTTGCTGATTGTACTGGGGTCGGGCGACTCTGGCAGCAGCAGCGGCACCAACCCGCACCTCATTGTGCTGTGGTCTGTTGTCA
TGATTTTCAGCTGTGTCCCCATGTGCCTGTCCAGTGTATATAAGGAGAAGACTCTGGGGGAGGCAGAGCTTGATGCGGTCTATCTGAATGGCTGGATCGC
AGTGTTCCAGTTTCTGTGTGCTATTCCACTGACGTTCCCGGCAGCAATGGTTGGCGACCACCCAGTCACGCCGAGTGAACTCCCGGAGAATATGTATGAC
GGCTTGATGTGCTACTTGGGGCAGAACACCATCACTGAAGGCGCGCACAAGGATGACTGCGAGAAAGCGACCATCTACGTGACGGCCTATTTGCTGTTCA
ACGTGGCGTACAACCTGCTCATCATCTTGATCCTCAAATTCGGCAGCGCCAACATCCTTTGGCTGGTAAGATCCTGTTGACATTTGGCCATTTGATCACA
TGAAGTAGCTTTCTCTGACCGTTCTTGTGTTGAACAGGCCATGACCATTATGGTTCCACTGGGCAACGTCGCGTTTACGTTTCCGTTTATGCCGGAGCAC
CAGCCTCTGCACACAAAGGACATTGCAGGCTTGCTGTTCATCATGCTGGGGCTGTTCGTGTACCGCTTCCTGGAGGAACTTATGGACTCTTGGAACAAGC
GGAAACCCGTGTACCCGGACGAGAAGGGCCCGGCCGTAGACGAACTCAAGCGGGCGCTCATCAGCAGCGACAGCGACAACAGCGATGATCAAGAAGTCTA
AGTAAACGGCATACAGTTACGGGTGCACTTTGCAGTGCCCGCCATTGTTAACGAATGAAAATCTATGAGACGTGTTACGTGTGCTAGTACTCGAAGCCCA
CTGCATCGTGCTGGTACAACTTACTTGACTTCAACCCGTCAAAGTGCTGTACGCACACATATAGGGGTTAGGTGTTATGTACACCACACGCTCCACGGAT
GGCTATCGCTTATCGACCGCAGAACCGGGAAGACCACCACTGCACATCGCTGAGCATGCTGGCCGCCGCCACCAAGAGCTTCGTGCGCGCCGCGGGCGCC
GCCGGGTCGCGCCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTCTCTTCTCCGCAGAAGCTTCGCCCGCCGCGCCCGAGCAGCCCAAGCGCGCCAAGCTCA
AGATCCCGACCAAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGAGGCGGAGGCCGTGGCCAAGGCCGCCGAGGGAAAGGACATTGACAACTTCAAGCCCGG
CGATTCGGTGGAGGTGCAGTACCTGCTGAGTCGCACGGGCGCCCGAGTGCAGCGGGTCAAGGGCGTGGTGCTGGCGCGGCGAAACCGCGGCACGGGCAGC
TCGTTCGTCATCCGCAACGTGAGTTTCGATGCGTTTACGCTGCAGCGGTGAGAGGCTAATTATCATTTTATTGTTTGTGACAGCACATTGGCGGCTACGG
CTACGAGCAGAAGATCTTCCTGCATTCGCCGCTGCTGCAGAGCGTCAAGGTGCTGCAGGAGGCGTTCATCCACAAGGGCAAGAAGCGCGTGCGTCGTGCA
AAGCTCTTCTATCTGCGTGAGAAGGCGCCCAGCTTCACCACCGTCTAGGCGGTGCGGCTACGACAGACTCGGCGGAACCAGCAACGAAGTCGTCACAGCT
ACCAGTCGTGCAGATGTCTGGATGGAGGTAGCAGCGCTGCTGGTTAGATGTAAGCGGCACGGGTAGGGGGGTGGTAGCAGCACTTAACACTAGAGAAGAA
AAACGATTCACAGACCACAAGCTACAGACAGGAACAGGGTCGTCTGTTATCGGCAAAGGGCAGCTCGTTTAGTCAAGCCGCTGCGACTGGGGCAGCAGCT
AGTATCTTGGCGCTCCCTCTATCTGCGTTTCTTCTTCTTGGACTTGCGAATGCCAGAGCCGCTGGACACCACGACGGCAGCGGGCTTGTCCGACTCGGCC
TTGCGAGCAGCACGAGCGGCTGCATCCAGCTTGAGGGCGTCCTTCTCCGTGCCCATGCCAGCACCCTGCGCACCGACAAAGCGGTTGCGGCCACGACGGC
CGCGCTTGCCGTGAGAGCGCTGCTTGCGTGGAATCCAGCGCTCCGGGTCCGGGTTCACCAGCCCAATAGACGCGTTGTAGTCCGGACGAGCGCGCAGGTT
GGCCAAATGAGTCTCTCGACGCTTAGCGCGCTTGCGAGCGATGCCCTCCGGGCTCTTCGCCGCACGTTTGCGCCTGTAGGCAAAAAGTGAGGTCAACATC
TATGTAGAGAAACAAGCTAGCAACACGGTGCCCAATACGTACTCGTTCTTCTTGTCACCAGTGTCGGCAAACTTGGCGGCCAAGCGGTTCGAGCGCGGGG
CCTGTTTCTCCAATTCA