Description :
From Genome Similarity Track
Location :
Scaffold_155:6595- 8349
Sequence
1754 bases(100 bases per row)
GTGCCAGATGCTTACGCTCGGCTAGATTGGGCTGAGGCCCAAACGAAACACCATGTTGATGGCAGCGGTACACTGTATCAGCAACTAGAGGTGTCAGCGG
ATCAGTAGCGAAATCCAGTCGCGCGTCCCCATTGACGACCTGCATTCCTGCCGTGCCTTCCTGGCTCAACTTGGTTGGGAAATTTACCTCATTGTATCTC
TCTGTAGGTGATAGGTCCAGGCTGCGCTTGGGGGCGGCACTTTTATCCAGCCTCTATGGGGTTGTGAGCTGCTATGAGCAAGAGATCTCTCGACTCGGCA
AGTACGACAATTTGCTGAAGGTCCGATCGTCGCCGGGGGTGTTAAACCGCAGCGTGGGAGAAGTCTAGTATCCCAGTTTCGTATCCCAGTTTCCTTGGGA
AGCGAAATCATCCAGCTGTCCACCCCCCTGTAGCTCATCAACGCTGTGCGACAGAGTGCTCGCGTGGTTGCACTACGGTACATGTAAAATAGATCTCTCG
ACCTCACCTTGAGTGATTCAAAGTCAGCAGTTGTGCGTGAATTGCTCCGGGAGCTTTGATGCAGCTGATCGCAGAATAGGTTGTGCAATCCTTTTTTGAA
ATGCTTTGACGACTGGACATGCTGGTAGTGACTAAGTGTACGCATACCAAGAATAGTCGTCACGGTGCCTGCGTGCACAACACAAGAAATTTAGAAAATG
TAATAAAAGTAATGAAAATACTCTCCGGAAAGAATTATCGATAAAGCTCATTGAAAACGGAACAAAATTCGCATGACGTCTCGGCTGTAACCCCAGTGTT
TCATGTCATAATTGATTTTAGTACTTGCGCCAATACAAAAACTAAGCTTATAACGAAAATCCCGTATATATTTATTGTCAATAATTGTGAAAATACTGTA
TTACTGGCTGACCCTGTATTGCAATGATTATTACTGTGACTCCAAGACCAAAATACAATTTGATATTTTATTTTCCGACCTCTGGAATGCAGGCATCGGG
TCCATGATGTACTTCACACTCGCGATGAACATCGGGTCGTACGGACCTTCCACTGCGCTCACCAGCCAACCAATAATTATGTCTTAAACCTAACTAAAAT
ATTTGATGGAGTGGCCGTCTCAGAAGCAAGCAACAAAAGCAAAGGGTCGAGCTCTTAATTTTCAAAAAAGCAGCTCAATTTTTTATTAGCAATATTTAGA
TAATAAATAACATATTAGTTTTTGACGCTATGCCAACTATTACTTCAACTAAAATAATTGTAAAAGTCCATGTTACGAATGATTTATAGTTTCATTCCTA
ATTGTTTTCATCAAAAAAAAGTTACACTACAACTAAAATGAATTATAATTTTAAAAATGTGGTTTTCTGTAAAAAACACGCTTACTTTTATTGTACAAAC
GCTTTAAAAAGACCTTTAGAGCACATAACACACACAACACACATAAACATTAAGCGGTTTTCACTTTCGCGAAAGTGAGAGCCAAAAGAGCGAAAGTTTT
CGCTCCTTTCACATTTGAAAACACCTAATTATATTTTCCCTTTTTTCATTGTTCGGGATCTTTTTGCTTGCGTTGGAACTACCAAGATGGTAGCTAATTG
TACTTGCTGATATTTCTTTAAAAAAATTTCAGTAAGTACTATGTATCGGGCACTCGCTTGTACTATCGCCTTCAGATCCGCATATGCGTTGATGGGAGGC
TTGGCTGCTGGCGTTCCCGTGTGTATTATTGTAGGATAAGGAAGCTTTCTCCCA