Description :
From Genome Similarity Track
Location :
contig_28:6594- 11550
Transcript NameFunction/comments
g5551.t1hypothetical protein PHYSODRAFT_522429
g5552.t1hypothetical protein PHYSODRAFT_523388
g5553.t1conserved hypothetical protein
g5554.t1hypothetical protein PHYSODRAFT_318537

Sequence
4956 bases(100 bases per row)
AGACATCACCTGAACGACAAAACCCACCCTACCACTCCCGGTCTCAACCTCGCTCTAAATTCCGAGGTTGAAGTTCGCTCTGTACTCTTACTGAATAAAT
GCTGAATTTTTGTCCCCACGACTGGAAGTACGAAGAAATCACAAATTCTGTTTTTAAATTTTCAAAATAACCACATTGAAGCGGCATTGCACCATCTTGG
TCGGAAATTCCTCTCGTTCAAAATTAGCGGAGAAAAACAAGCTTTTTAGAAATGTCAACATTTGTATCTCAAGCAACTACATCTGCTTCGGTAGCAATGC
GACTTCTATCGACCAAATCTAGGCTCTCTACTTACAAGTTTTCTATGAGAAACCCGTCAACGCCAGAGCCATACGCCGTGTTGATGCTGTAGCCAGCGAT
AAGCACTACTGCTGCTATAACCGAGACCAAGTTGCCGATGAGTCCGCAAATGGTGGCGGCACCGATCAACACGAGCCAGAACATAACCAGCACGGCCATC
GCAGGCACTTGATCCTGCTGAAAAAGCGGTTTTGCTCCGTCCGGAAGCTTACCATTCGACTCGTAAAACGCCTTCAGCAAAGACTCCTTGCGTTCAAAGC
GCTTCTCCACCCACGTCGCAAGCTCGCTCTCGCTTTTGTCGCGCAGCGACGAAATGTCCACACGCTCGAGGTAGAAGTGGATCATTCGCGGCACACGACC
AGTTAGCAGCGACGTCTCCGATGGACGTTCGTTTGCGGCGTAGTCCACGTAGAACATGGTAACATCGTATACAGCGGTGAGTTGAGAGCGCAGTAGCGGA
AACATAAATGTCCAGCCTGTCGTACGCGGGTACAGCGAGTACTGACGTGGCGGCAGTCCGTTCTTCTCGGCGAATACAGCACTCTTATCAAGGTTACTCT
TGCTCAGATCCGTACCTTCTGGGAAGAGGAGGTATGAAGCCTCCGGTTCTGCCGACGTGAGGAACGGCAGCAACTTGCGCAGGTTCACTTGGTCATCAGC
CCAGCGGCGTTGCTGTAGAGAGCAGACCCCACGTTAGCGCCTCACTCTCATTGCTTCCTAAAGTGTAGATGTTACCAGAAATATGAAGATGAAGTGCTGC
ATGGCCCAGCCGAAGATGGGGATTTTGCGCAGAGGGGCCTTGAGGACGATACGCAACTGGTGCAGCGTACGCGTTCGCCAGGCCACACTCCACAGCAGCA
TCCAGTCGATGCGAGTGCGGTGGTTCGACAACCACAGTGCGCGGTCTTGCGGCATGTCGCTCTCGTGAGCTTTGGTCTCGGCGTCGCCGTAGACCTGCAC
CTGGATGCCAAACAGTTTCTCTGGCAGAAGTCATAGTGAGCGTCTCGCACTGCCAACGGCTTCTATAATACTTGGAAGTGGCAGATCCACGCACCCAGAA
GCAGCACGACTTGACCCATCCACGCCCATTGTCTGCTCCAATAAACACAACAACAGCTCATTGAGTAACAAACCTCCCGTCATCCTTTGTTGGGATTCCA
CCGACGCACATGCAGCGAGTGACGCGGCGGTAGAAGCGTTTGGTCTGCAGAAACGCCGGCAGAGGCAGGGCCGCGAGCACGAAGCACGGGGTCAGCACCC
ACGCTAGGGCTGTCCAGCCCGTGAGCGCCAGCGATACCAGGAACACGACACCCACAACGGACACTCGCATGGTCTCCGTTGCTAATTCTCAATTGATACC
ATAAGCATCTGATCGTAAGTTATAGGCTTATCTCCTAAGATATGTGATACATATATTTATACAGCCTTAGGAGATATGTTACACTGTATATCCACTCGCC
TTCTTCAAGATTCATTTTAGCTTTGGAGAGGCAGAAAATGACGACGAGGGAGGAAGCGGAGCGCGACGTGAAGCTCCTCGTGAGCTTCGTGGCCATGGTC
TTCGTGGGACTCGGCAACAAGAGTGCGTGCTAGTCTCTAATCTGCACAATAAGGTTCTTGTACGGCTTAAAATCTCCCAACTGACGCACTGTTCTCCGTC
CTGGATGAATCATTCTCTGCTCAGTCTTCCAGAAGTGAGTTTTGCTACACTTGGGGTGCAGCTTTACTTGTGATTCGTATACTTAACCGATGACTTTGAT
AGACTGCAGACCATCCCGATGCACAACTACCCGACGTTCCTCAACCTGCTCACCACGTTCGTCTACGTACGTGCGGCCTTCGAGTGCATGCTGTACGCTT
TACTAACTGGGTGTTGGATACACTGCAGATCCCCATCAGCTTCGCGTACATCCTACCGATGATAAAGTATGGTAGTGCCATCACGTGGGACCAACGCAGC
ATCCCGAAGCGGAAATTCGCCGTTATGGGAGGACTCGACTCAGTCGCCGGCATCCTGCAAGTGTTTGCAGCCACCTATCTGGGTGGATCGCTCATCATCT
TGCTTGGACAGGCTGCGATCCCCATTTCGATGTTGATCTCCAGTCTGTTGCTGAAAGCCAAGTACTCGGGCTACCAGTATGTTGGAGCTATGGTCGTGAC
GCTGGGCTTGCTGATTGTACTGGGGTCGGGCGACTCTGGCAGCAGCAGCGCACCAACCCGCACCTCATTGTGCTGTGGTCTGTTGTCATGATTTTCAGCT
GTGTCCCCATGTGCCTGTCCAGTGTATATAAGGAGAAGACTCTGGGGGAGGCAGAGCTTGATGCGGTCTATCTGAATGGCTGGATCGCAGTGTTCCAGTT
TCTGTGTGCTATTCCACTGACGTTCCCGGCAGCAATGGTTGGCGACCACCCAGTCACGCCGAGTGAACTCCCGGAGAATATGTATGACGGCTTGATGTGC
TACTTGGGGCAGAACACCATCACTGAAGGCGCGCACAAGGATGACTGCGAGAAAGCGACCATCTACGTGACGGCCTATTTGCTGTTCAACGTGGCGTACA
ACCTGCTCATCATCTTGATCCTCAAATTCGGCAGCGCCAACATCCTTTGGCTGGTAAGATCCTGTTGACATTTGGCCATTTGATCACATGAAGTAGCTTT
CTCTGACCGTTCTTGTGTTGAACAGGCCATGACCATTATGGTTCCACTGGGCAACGTCGCGTTTACGTTTCCGTTTATGCCGGAGCACCAGCCTCTGCAC
ACAAAGGACATTGCAGGCTTGCTGTTCATCATGCTGGGGCTGTTCGTGTACCGCTTCCTGGAGGAACTTATGGACTCTTGGAACAAGCGGAAACCCGTGT
ACCCGGACGAGAAGGGCCCGGCCGTAGACGAACTCAAGCGGGCGCTCATCAGCAGCGACAGCGACAACAGCGATGATCAAGAAGTCTAAAGTAAACGGCA
TACAGTTACGGGTGCACTTTGCAGTGCCCGCCATTGTTAACGAATGAAAATCTATGAGACGTGTTACGTGTGCTAGTACTCGAAGCCCACTGCATCGTGC
TGGTACAACTTACTTGACTTCAACCCGTCAAAGTGCTGTACGCACACATATAGGGGTTAGGTGTTATGTACACCACACGCTCCACGGATGGCTATCGCTT
ATCGACCGCAGAACCGGGAAGACCACCACTGCACATCGCTGAGCATGCTGGCCGCCGCCACCAAGAGCTTCGTGCGCGCCGCGGGCGCCGCCGGGTCGCG
CCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTCTCTTCTCCGCAGAAGCTTCGCCCGCCGCGCCCGAGCAGCCCAAGCGCGCCAAGCTCAAGATCCCGACC
AAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGAGGCGGAGGCCGTGGCCAAGGCCGCCGAGGGAAAGGACATTGACAACTTCAAGCCCGGCGATTCGGTGG
AGGTGCAGTACCTGCTGAGTCGCACGGGCGCCCGAGTGCAGCGGGTCAAGGGCGTGGTGCTGGCGCGGCGAAACCGCGGCACGGGCAGCTCGTTCGTCAT
CCGCAACGTGAGTTTCGATGCGTTTACGCTGCAGCGGTGAGAGGCTAATTATCATTTTATTGTTTGTGACAGCACATTGGCGGCTACGGCTACGAGCAGA
AGATCTTCCTGCATTCGCCGCTGCTGCAGAGCGTCAAGGTGCTGCAGGAGGCGTTCATCCACAAGGGCAAGAAGCGCGTGCGTCGTGCAAAGCTCTTCTA
TCTGCGTGAGAAGGCGCCCAGCTTCACCACCGTCTAGGCGGTGCGGCTACGACAGACTCGGCGGAACCAGCAACGAAGTCGTCACAGCTACCAGTCGTGC
AGATGTCTGGATGGAGGTAGCAGCGCTGCTGGTTAGATGTAAGCGGCACGGGTAGGGGGGTGGTAGCAGCACTTAACACTAGAGAAGAAAAACGATTCAC
AGACCACAAGCTACAGACAGGAACAGGGTCGTCTGTTATCGGCAAAGGGCAGCTCGTTTAGTCAAGCCGCTGCGACTGGGGCAGCAGCTAGTATCTTGGC
GCTCCCTCTATCTGCGTTTCTTCTTCTTGGACTTGCGAATGCCAGAGCCGCTGGACACCACGACGGCAGCGGGCTTGTCCGACTCGGCCTTGCGAGCAGC
ACGAGCGGCTGCATCCAGCTTGAGGGCGTCCTTCTCCGTGCCCATGCCAGCACCCTGCGCACCGACAAAGCGGTTGCGGCCACGACGGCCGCGCTTGCCG
TGAGAGCGCTGCTTGCGTGGAATCCAGCGCTCCGGGTCCGGGTTCACCAGCCCAATAGACGCGTTGTAGTCCGGACGAGCGCGCAGGTTGGCCAAATGAG
TCTCTCGACGCTTAGCGCGCTTGCGAGCGATGCCCTCCGGGCTCTTCGCCGCACGTTTGCGCCTGTAGGCAAAAAGTGAGGTCAACATCTATGTAGAGAA
ACAAGCTAGCAACACGGTGCCCAATACGTACTCGTTCTTCTTGTCACCAGTGTCGGCAAACTTGGCGGCCAAGCGGTTCGAGCGCGGGGCCTGTTTCTCC
AATTCACTAGGGTCAACGCCGCTCTCCTCAACGACCGGCAGCATAGCGCACCGAGC