Description :
From Genome Similarity Track
Location :
Scaffold_196:6593- 8739
Transcript NameFunction/comments
Physo_144534reverse transcriptase

Sequence
2146 bases(100 bases per row)
TCCTTCGGCGTTCTTCCCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CATGTCAACGAACAGACGTGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACCACAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAATG
CCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATATACTGCCAACACTCCGACGGAGTCGGTAGTGACTGCAAGGGAGCCT
GCGCGAAAGGCGCAGGCGTCACACGTCGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTATACTGGTGGCCCAGTAGAAGTCTCGCGTGAGA
AGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATACATGATCCTGAGTCGCAGGTCGTGGTCATTGGGAACGACAA
CACGGTCCGCGTTGTCATCGACTGCACTGTAAAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACG
AGCTTTGTCAGAAGGCGCTGAGCCATAGGTCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGG
GTGCTCGATCGCACGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGG
GTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCTGTCCGCAGCGACGT
GTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGG
TAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGT
CGGATGCGTCGCACACTACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCACCTCAGTCAAGCCCCTCTTGACTGCATCGAAGGCCTGCTG
ACACTCAGCAGTCCAAACCCACTCGGTGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCACGTAGTCTTTCACGTACTTGCACAAGTACGTG
GCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCC
CAACGAGACACCCGAGCACGGGTATGTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCG
GAGATGCACCTTGTGTATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAG
CGCAACAAGTGCGTCACGCACCTTTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACCAGCCACTCCCAGAGCATGCCGCTCGTCGTGCTCA
CTGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAGCCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGAT
GATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTATGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTG
ACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATTCCCGCACTT