Description :
From Genome Similarity Track
Location :
Scaffold_27:65929- 95389
Transcript NameFunction/comments
Phyca_LT153454256GPI ethanolamine phosphate transferase, putative
Phyca_LT1534507345Hypothetical protein
Phyca_LT1534114967unnamed protein product
Phyca_LT1534507349phosphatidyl inositol kinase (PIKG1) putative
Phyca_LT1534547917predicted protein
Phyca_LT1534507351AlNc14C82G5326
Phyca_LT1534114751Hypothetical protein
Phyca_LT1534567915pre-pro cysteine proteinase
Phyca_LT1534547924Hypothetical protein
Phyca_LT1534114768unknown
Phyca_LT153442475unknown protein

Sequence
29460 bases(100 bases per row)
gtggtggcgcttccttgcggattctccatccacgcattacctgtacgggttgtgccctcttatcttgtggaaatttgtgtggagacatcgcggtcaactt
tacgcagcgcttcccccaagaggttcacgctggaagtggagtgtacaagttgcattaactttcctatgcttggaacttgtcgttttcggttaccaccacc
gtgaatcgttttgcttgctgtttattttactggcgttgcacccgagagtcataaacaacaacctctttcaagtaaagggcagcgtccagttgaatgaccg
tctacactggaggaaatggttgacgacagatttttattggtctacaagctgcgttttaatcgctgttttcccgtgtctaccgagtgagcacgatcaaaac
acgacgttggttcatcttggcgctttactggtactattttctactattgctgtggttcgcaatacctcgggtgcccattatgaaagatcccagtggaaga
cggttcttttgcctgggggtcttcctgtgcttctggctatgctggctctggaatggacgttgacctacctggaaagtaaaactactccccccttgcttct
tgtggcgtcaaactggctaatagtcgttgtaccaataacctggttactcgttcaagcaatgtgtagcagcaaaaaagagattcgctcgttgaagctggaa
gataatggtgatcttgaacgtcagcaagttggtggggaggttgcacgcctagcggttgtacgtttaacgcaggcaatcttagctgtcacaccaggcttga
tattgcttagcacatcgtatgaagtgctgtttttcgcagcattatcaagtggagtcgttagctgggtgatgacagaagcaaaacaaacagcaaacggagg
ggtctccgcgtctcgtgaagtgcagagagcgttattgctcttactgttcgtccaagtttcgtttttcggcacaaacagtgtggctagcttgacaagtttt
aagatcccatcaacgcagcggttcttaacagaatcctccatcttaactgcacaagctcttgtcgtactgaagctcgcgattccattcgtgattgttggat
gcgctttccgtctgatcctactgctaccatcaggggcagtctcgacacaagagaaggagttgcgtgggaaatctctgtgggtcccgcggtatttccttct
aaccgcatcactggcggaggttctggttacacagttcctctttcttgtaaacaatgaagggagttggagacagatgggaaactccatcgcggaattctgc
atcgtcaatgcccaaattgtccttttgccgacactggtaattctcgcctctgcgctcgtttacgacctagaaactactcccagaggatacgaaccggtag
acgaaaatgaaggcgaaggcgacaaggacaactagaaatcaagaaataattgtatagcgtgctttcaagtgagtcatcgactatgtatcgctggaaacga
ttcatttgcacgtgacaagctgcgaccaggataattcacacgcacgaagggaggctactagctccacgttttccagtggcaacgaatactcgcgtgcaca
cgagctttggcgtttgcatgcacaaccttgcaatcgagtccgtttcctcgaagatggtagagatgtacacgagcacgtccgagcttaagaaccagcagat
tccatgggtcactcaagaacaccagattcataagcatgcgctgagaggatgatgctgagctcgctacatcgctaccattcgaagcaacgttatcctcggt
ggtcttctcgtttggaccttgtttctggtcgatgctacgttggcttcgctggcttaaccacggagtagtagcagtcagcataacgagcaaaggtcccagt
agatcatcatcccagctcacagaaagacagctaggttcccaaagagctcctgcggcactgggaacagctgaacgagcaaagaacaacgggtcgggcacgg
catcgcccctcggttggggttttgactgacttaagttcgttggtttgacccaacgacgtcgatgccaacgtatcagctggcgtactgcgaggatgacgac
gacgtagataatagcagcaagagcaactgccaacatatcgctgtaaactccttcaaggttcattttccacgcatccagcgtctcggagcgcagcagcatg
aaagtcgggacgggttccacctcattggcctccaagatccgtgcatcgcggtcgtcaacagcgattcctccatgtgctacgaacgctacagctccaagag
ccaaagcggggagcaagtggccccgaactcccgagactccgtgcgaaggggtccacgctcctgccgaggtctgcagcaatgctcgaaaccgtgctagtaa
cgccatgagccaaacgcagcgcatatgcacagccagccaccgtgtcaaagctacaaagctatcagtggcgttctctccaccgtcatcttccagttcgtaa
agaattaaagcgtcaatgatgtgtgcgcttgcgtagcacaacacaggtagccagctgccatacacgacgacctggctgggaacagcaaaaaagactcgta
acgtacgattcagtctcgatggatccgtgctcgcaacgttgccaaaagccgagcatacaacagcgtagcaagcgacgagcagacacaaaaccctcatgat
cacatacgcctgcccaatgaaccgcagagtggatgccaaggaactccattcgagagcgtctgtatacagcaccttgccctcaatacgttcctcaaacaac
gtagtagttgtgcaagtgtccacgctagtgcattctctgatccggtacagtgctacaacgctgtaaatcttatgtgcaagcagtacagctccacccagtc
tggtcagagggtccgattcagtctccactaaagtgacatccagcttttcatccttggccagagtcttctgtagctctgcaactcgttccgatataacttc
ccatgctgcctcactctcgctaccgcccacagttaacgatgcagcccatggtttctcgcaaaagagggggcgatccaagtcatccacgcacaagtccaca
cctgggttggtagggtccaggtcagcaaaagtagtaacccagacgctgagccagtacttgtggtctagcaagttccgcgaaaggaagctcgtactgctac
ttgcagccgtcgaaccagacgctgcactgcttgtacctgtccagcgagctttggcgcgtgccgaaaagcacacgcgctgcggtaatgaactcagctcgcc
tcgtgccatgatcgcgacgccatcgtctgtctgtgccacatttttgtagctcgtcgtgctcggtgcattggctgcaagtgcttcaacgagggtatcaagc
atctggaacactgtctttccagggaggaagtcaccacagtccttgctgtactctgatcctgcagagagatcactaaggatacatgcaggccaggacgatt
tcagctgtgccgacgtatccagcaggtcccgagccgtacgcagtccataagagcttggtgtaaacttatagaatgccgtagatacttcggaagagcacgt
ggacgacccagcagtggagattgtgccattctggaaaaacgttcgacctgcaagtgccgtgggtccgtacaccgtgaagacattgggctcgatctgcacg
aacgggagactgtcaacacttgaccccgcccgagggacgtcagatacaagcaatgcgtaggcaaacagagcgagaagaactcggagggctgtggactgag
gcagtctctcaacgaacgtcgccgtttcgtgggcgccttccgggtgcatcgcattcagcatcaacgacgagcgtttgcgctgccaattggaatctgtcga
ggctggagctttggctggcagagtattaaacgatggtgctttcgtggccttcgtggtgtcattcgtattcgtctctacttcatgaggcttcttcgacgtc
tcgcgatggctgccaccacttacgccgccgtcctgtgaccccatgacgaagaaggaatgtccgtcaggagcgactgttccctatgggtcggcggttaaaa
caaagctaaatcgctggaaatatcccagccacgagtgtacacactgttcctatgaccacctcctagcatcatatccagaattccatccatacgaatgggt
catttaagagctacttggagtacgttaacacccacaagctttctcccttcttctcccttgtttctatgcatcacatcgaatggctgcggactttacaccc
atccgagcgtgtgacttgctcatgtgattatgggtaaagactgctgaccatgtgattatgggcgagggttttgtaggttcaaacaaataacagcttgtga
ttggatgaaatcactctaaaacagcttgtgattggatagaatccaacattggggtatctcatacccgctgaacatggactcattccccaacttgctgcgt
cggaaagctctcaacttgcttcctctacgaccgccaccatgagcatcgattggtcactcgagtgctgcaacgacaagcagttcctgtccatcttccttat
catctgttatgctctcgtcattttcaagctgtaaggcgcaacaccttgtcgtctacttaatgaacctaccaaactaatcattgacccttgtcgatataga
tggcgcgtctcgatcctccacccattcaagatcctgtacgtttgcttaagcattctttgtgtacactgaatgaaatcaagttctaacgcttgttgctctt
gtttacagaacggtgtttcttcacgagcttgggcacgcgactgccgcttggctcacctgtggcagcgtacggagcgcagttgtaccagctatactgtaag
attctggtgcttacggaactattgtggcaatactgcaggttaaaggcatggaagttcacccggatgaaggtggcgtgacgaagactgttggtggactcca
gtgggtcatcctcccagcagtaagccattgttgctcaactctctgttgcacttcaagggtttaaattgacttggtccgtgtgtgatggtgctaactgtag
ggctacctgggatctgcagtatggggtatggcgttgaccatcgctagtgcggacaaaacggcatcggaagtggcagcaggcgtcctcatctttttcctgc
tggtcttcatcttctacgcacacaatggctaccttcgtatcctcaacttctgcttcattctactgcttgccggtctcttggcgctgaacatttggacgac
attcgatgctttgcagtacgtgacgctcttcctgggtgtcatgagctgcctcttttcggtttacgacatctgggacgacctcatttcccgccgagtaaac
gagagtgacgcgtccgtctttgccaagatgactcatacgtcaagtcggtgctggggagttatctggggcctcatcgcgctcgtctcgctcgttgcagccg
tctatttcaacctgctggtcgctgaggattcgggtccgtcgcttaccaacatctccgacgcgtccacaggcaccaaaatcgcacttgcttgcgctgtcgt
catcgtggctctttctgtagtgcacacaggattcacgcggaggtgcatgctgcgaaaacgcgatggttttggcagctactttgccgcttaaagctagata
tgatagcgacgattctggttaatcggccaaatgatattcttctccatccttgtagattttggctcaccctttgctgataattcacgtatacactacctac
caaaatgctacgtgctcgatcaagcacgcaccttatagcttctaaggacatccgcaaaagagctcacgagttttattctcttgcgacgagagctcaccta
cgcaaggatgccgttcgtcatgcgctggaaattgtcatattggcgcgtgctgtagttgttgttactcttgcgaatgagcgacagcacgtgcgctacagtc
tcttgcttggtcagcgtcaacttgaaacgagagcgcaggcgcaataaaatataatcagcgtcgatgcccaggaagcacgggtacggcgattgacgcgaca
tcacgtccacaaggtcgcagatctcatcgcagtgctgctgacacgcaagaaagccccgcgtgcaaagtgtcacgtactccttgaagccctccgagtcttg
gcctcccatggtctccaccatttcggctgtcagcttgaatggggccgtctcgatgctcagcattccaccaggcgcgatgccaagcaagaacccatagtcg
atgtggataatgtggccttcgttgtccagcatgatgttgccgttatgccgatccttgatttggaggaagtagcacacgagtgagtaacctgccatggact
ggataaacttccgtcgcgcttccttgaaccgatgtgagtcaggtgggccataagacttctcaaagtgatgaagaagtgaaacgtatccctcacgcttctt
tagcccgtccaatgagattgcgttgataagagtctcgattagtccagtggacgaacttgtagcgataatgcggtatctcttcacccacatcggcagatgc
gcgcctttgaagatttcaacaaacttctggatcaactgcagcgtaaaaacttcctggcgaagatcatcattgctcttaccaatcatggacacgatgtccc
acccaggcaaatggccgtaaggcgaagcagccatcattcttgctcgtttggaactccaggattcgccaaaagctgcctcaaaatcccgacgacgggcctt
ctcacgctcaattgcctccgctgtcaaatcacccgttgccaagtccaaaggcgtagaaggatggccctcagttaccactccgtctgcagacgcgttactc
atcgtgcgtccagtcatgaggactggcggagccgttgatggcgttgagacaatgtcaggaacgtcaataggcgtttccggaactggtgcacgccgcggca
cggcgactggggtatggtatggctcgggaacaacaggtgcagggggtggcataataggttctggtgggatttcctccgcttcctgggcgtcaccagcaaa
cgcatcactggcctgatgtccaatcagttgaccaatttcatcgtcatcgatgtaatttacctcggaagactcatttccgttaaggttttgccttggggat
cgtggagatcctagaagtgaggcatcctgttgttgttcttcgtcaaatgggttaccgcggatcacctcaaagatcaacaaaatagggactcgtgccttcg
tcgaaaacgcagtaccttccttggtgggtatccgtacaattctctcaaacgggtcggtggctttaaccagcggtacatacgccatgggcggaagatgtag
cttctccaaatatgacggcaattgggcctttcgatcctggatggatggcacaaagcgcaatgcctcagcgatgtcggtgatctgctccacgaaatcacat
tcatcagcgaagtgctttgctagcaaagacttgtctgtctgactcatccgtcgcatagactcgctaaatatgctggttggttggttgtcagtatcctcct
cttcaagaatagacaaccgctcatcgtgttcgtagtcgtcacctgtaggatgcgaaagtagcatggagtccaggtcttccttgggtgtgagcaggtgttg
ctgaaagcgagagaaatcacggaatcgactgtccacatctgcatctagcgagttacgatcagtagattttctcgccggaggtgaaattggcgagtatgaa
tccatgccagcaggagagccattgatagatgtgatgctatgggcttgtcgacggtgagtggcaatctcctccgtcaattttacgataacctgcaactggt
catccgtaggcatcggtaaattgcgcttgtgaacctgggacgcttcttgtagtggatcgcgactgagtactgttgcacggtccacacctgcgacctcacg
ttcaatttcgaccatcaaccgcaccacgcgcgcatatttatccagcatctccttgggttttcttatgtcaaacgagtcttcgagcgcaccttgaagctgc
catcgaagaagaagagcaaggtgaatagagcgcgaacacaccgataagatgagctcatccagccagaagatcttctcgaagtcaaaattcgggatcgaaa
ggtaggcatggacaatctgaggccagtagaactccacttggttgatacgcgtgtacgaaaagtgcagcagcttctccacaataggcttgaacaatagggg
atcactatccaagtgacgatgcaacaaaatcacagcccgataaacgctgaaactgcgcgcacggaactcgcgatggagacccaagattttcaggtctaat
gggatttctggatgatccatcgtgtgatcataaaatcgccggtctttaagtaggatctcctcgcattcttcagcagtgataacctttgctttcaataaat
caatggcaattttggccgactctgtctggagtggacgtttgggcataatgagctcgatcggtgcctcggggtttagtggtttcgggtacaagcagatacc
cgctttcagtctttccaccattgctcgcaagtagttaatgtaattctgcgcctcgtaacaacggtcacacacgcgcttggcgtaatagtgcgatctctgg
gggagcggcaccttatgcgtcgtaaatttgtcacaatacaacccatcgcaactgttgcacttgtatagcaaggtcgctgctgtcggtgctggttggcctg
cggcagcagcttcagctgccaatcgggtacaatccggacacttgcacgtcacgtccgtctccgtggtcggcaccgtcacagtgctcactggagagacagc
cacatccaacgaggcatgctggaagaaggccgctgcaaggcgcggtactgtagtctccactgccgtctggatcgctcggatccatttctccttgtccatg
gctgtgtctgcgtaagcgtagaaaaccttgttctgtgccgtagcgaacaggaagccgtgctggtaaatgtgcatgttgcctttgccgtcccattcctgca
ctcctttaacatccacctcgcccttaatccgcagcatgtgataagcgtcttcctgtgtgctgcattcacatcaacaaccatacacagggttttcagcatg
gcgtaaagctatcaaaccgacccaattgtatctactctacctgtagtagtggaaagaggtgcccacaaggaaacagtaacgccgcaacataggcggaggc
gaggacgggctggtgcggaaggtcaaatagccttcgcagctggcgcgcgcagccttcatggcgctccaagaaatgagacgctgcctgctacgacgctgga
gtctcgtagtggcactcggcgactgtgggcgctcacgatggggcgccgaaggtcaatctacgcgtaatttagcgcggactggagcgttctgggtatcaag
cgattgcttgacttctacggagacgatactcgcgttcaaaggctcgtcagaaagaggaggcagcagggaacacgaagaacctagagcgacaggccgcaca
ccgctaggagaggagctacagcgagagagaggtgctgacccggagcgcgagccttctctcttcaagtgggcgttgcggtgttgtgtgggaggctcccctt
tgtgtgggcattaagaacccgcgggatgagtgatggtcccgtagtctcctgaatcccgcgggaaaattcacaatggtacagaagtggtacacttagtttt
gctggttgcgagccgtccgcatcagcgttaccagtgtcaatagcgacaggaacttgatggctcgcgggaagaagacagcagcgccgctgaaggcatccac
gcccagtgccaatggaggcaacaaaggcaacaagaagacggcgggagtcgctgcaaagaagcagaataagccggtgcaaactcctgctaagactaacaag
aagagtgctaagctgccggtaaaggaagaaagcgaagagagcgaagctgagagtgaagatgaagaggctagcgacacagaagacagcgacgaggcagacg
atgaggaggatgacgagttcgaggaccaaggatcctcgtcggacgagtccagcgatgaggaaggagaagaggaggacgctgagctcacggagctggagaa
gaagacccgccgctttacagtggaccgcgagaaggaagtgcagaagatgcgcgaggatggatctctgtcagtggcgtctcagctgcacgtggacgatttg
tcgtctgacgacgaggaaaatgtcaacactattggcaacgtaccgcttcgatggtacgaggactacgaccacattggttacaatgtggacggcaagaaga
tcatgaagagcaacaatggcgatggcatcgacgatgctattgctgccaaagatgacccgaactatgagtacgttgcacgatggggattttactgtcgttt
tcatgtagctttaattgagctgacattgtatttcttttgtttggcagccgtacagtgtatgatgcctacaacgaccgcaagattgttatctcggaccgtg
atatggaaatcattcgccgcatgcaggctggtgcattcgcacacccagagttcgaggcgtacccagactacgtggacatttactcgtccaacaagatgat
tcactccatgggcaacgacttggagcccaagagccgattcctgccgtcgaaatgggagcgtatgaaggttatgaagatcatgaagggcatcaaggaaggc
cgcattaaactcgaccaggagcccgaaaagaagcccgaggtctatcagatgtggtttgacgatgaccaggcgcagacgcgcaagggacctgcaaacgtgc
aagctccgaagatgccgttacctggacacattgaatcgtacaatcctccagatgagtacctgttcagcaaggaggagcgtcgagcttgggaagaggccga
acctgaggaccgtgagacgaactttatgccgaagaagttcaagtcgctgcgtgaggtgtgcggctacagtggcttcgtccgtgagcgctttgaacgttgt
ctggatctgtacttggcgcctcgtgtcaacaagcgcaagcttaacatcgatccggaatcgctcgtgccggagctgccgaagcctcaggatctgcggccgt
tccccaacactttggcactcgtcttcaatggccacactggccgcattcgctcgctggctgtggatccgtatggccaatacgtagcttcaggttcggatga
cttcacggttcgtatctgggagctggaaactgcacgttgcctgcaggtgtacaatgttggtgctgtggtaaacaagttgtcctggaacccgaacaaggac
caccagttgttggctgtcgctgctgccaagaaggtttttatcattgctacgggaacgggcagcgctgaccagacagaactcacaaatgctctcgttggcg
atgccgacgatagcattcagacgtccagtgagaaggatgacaaaacagacagcgaagtccaagttgtggacgaggacgaggcgagtgtggaggctgacgc
actcaaaaagaaggtgcctgttacgtggcggttctacagtggaacgaaggacaaacacaagtcaaagaaggctgcggagcgaccgtggcttgagcgtcgt
gtgggcactggcattcgtgtcgtgctgcaccacacaagcgatatcaaggacgtggcatggcattacaagggcgactatctctctacagttgcccccggtg
ctggttctagcgcggtgctaatccaccagctctcgaagcggaagacccagaacccgttccagaagagcgtgggccaggtgcagtgtgtgttgttccaccc
gtccaagccgttcttcttccacgctactcagcgccacgtgcgtgtatacaaccttgtcaagcagtcgatcgtgaagaagctgtcgtcgggtgtcaagtgg
atctcaagcatggcggtgcatccgaacggcgaccacctgcttgtgggtagttacgatagacggttgtgttggtttgacctggatctgtcctcgaggccat
tcaagactctcaagtaccacgagaaggctgttcgtgacgtgtcgttccacgctaaatacccgctcatggcttcagcttcggacgacggcaccattcacat
cttccacgctatggtgtactcgtacgtatcactaatggtttcgctgagacgaggttattgattaatttgactaacgacattgtgatgtttacagggacct
gatgaagaacccattgattgtgccgcttaagatcctgcgaggtcatgaggtctccggtggcctcggtgtgatggcgttggccttccatcctgtcctggta
cgtcttctctcctctgcttattaactatttgagcccaactaactagtgtgattcattgttttcgttagccatgggtggtgacaggcggcgctgacggttc
cattcggctcttccagaacattcactaactcgtccgttgcatttgagctttccacaacatggagttcccggcgtttcgtggacttgctagtaactgtggc
gatatcaaatagacaaacgtgcatgtgatagtcgtttctccgtttcggctcactctggtaataagatctttatgccctgctcgagtccatggcgaacagc
aaactgttcatgatgacggatggcaaagcatttcctaaagccagtgcattttgacccatctcgaacttcgacagcaagagttaatccaagatggcaagat
ggagcgcaatgtgttgaagtccaacagcggcgacatgacacgtgaagtccttaatttatttagcaatgcaaggaaaagaggaaggttaggctacagctag
actagtcgggaagctgaggctactcggcccaaagcagacggcaccgggtctccctcacgcaacagaatacaccacgaggctctttgaagagaccaccata
cttgtaccatcgtccgcccgcttgaggcgagagtgcgctcgcaacttccacagagccacgcgtccagtctttagttcttcttgcccatgccggggatgcg
gaaccgagattttttgggtgctgctgccggcattggaggaggcattgcgccgtatcgtaccgggtactggtactgacctcccagtgttgtgggagggtac
tgctgctgtccgtagccaccgctagattgcccgtattgttgttgctgctgcccgtactgctgtccattctgctgtccatattgctggccgtactgctgct
gaggttgaccatattgctgctgaggctgaccatactgctgctgctggggctggccgtactgctgctgctgttgctgtccatactgctgctggccgtactg
gggttgattgttgccgtagccgtaagactgctggttgttgccatagcctgagtgctgcggcgggtacgtgcctgtggccatgttgggagggtagccggcg
ttgttcatggggttggggcggttctcctcgtccgagttccgctggttgttgtggcttacgcgcttgccgttcatgtcgtaaagcgaggcttccgtgggct
ctccatcgccgtccagcaggctcgcgccgtctactttccccttgcgatccagcacggtaccgcccgagagcacggcgcggtctgacttcttcttgcgtag
gaaacccaccattctgactaaggactgtgtacgagtgtggatagcaaggaagaagaacgacctcttcttgctcgagctgctctgtgcgaggacgattcaa
gtatggcgcgcacgttggcttcgaggcgaaagaccagccggaaactggtgtccccctcccaagctctcgctcgatcctagccgccgctcctcttctatgc
tggcacgatttgtcgcaatttttctgaaacccgatcacttactttcagtatgaacatattgaaagcaagagttgaaaagccgcgaaaaggcgccagtaac
ttgcagcaatggtcaaatccacgtggacgcacgagcgagaaagctgccgacagatggcggttgactgagagaaactatggcgtcgtcgagccgccattaa
gagattccgaccgagggtcttggtggcaacaggcgtaaacgccagcatggagtgtagctgtaacttgcggcgtcttgaaaaagaccgtttcggttccttg
gaaagcggcgccagtgaaccgagggtcaaccaattttgcgctggtcaggggaggctcttcgacgtcttattaccaccactacagcaactgctgcatcgcc
accactagcgtcaactgccgcggcaggagtgaaggtttccgcaaaagcagaccatctgtggcagctagaacctgagccagcgatttaacgtttcatctac
tcgcatggatggcggagccacacaacgggcagcgtgatgatacgacagcaaagatactttcaatgttcgtgcaacgcatcggagtaaggtgcaagatgct
aggaacttcctagtccttgtcataacgtcaatttctattgtcatatttaggttgcaggtcaccacggtggtacccttttgaggctgcgacatgtaataga
aaatcttaataaaaatgatcttaatctaacgacacgacgacagcaattacatgtcctgccagcaacttgccatgcgagtagagcttgtgcgtgttgcgtt
cgagctccattgtcgaacgcgtcgcctggataagctcccccggttgaagatcaacggtatctaagtgaaacgccggatcagagtggtaaaagtgcctgac
catcgcatcctgcctgtagctctgtctgtctgtacgtcaccacgcacggaacgatgacacttcaaccacgcgcagccggcccgcctcagtggagtgcgtg
gcctcactcatgcccaacgccagcaatagaatttaaggtgaagccaagtgtaatcagaccagtgtgtgccgtcgcctctatcatccattggcagtgagta
cacgtacatgtacaacagacatgcccaacgtgctcgagcgttgcatcgagggggtgctggtgcttggaaagcgctcgctgtgttcaaagcaatggtttgt
aagcatttcgcatggatactggacgcgcatattcatgacatgatgaactggtggatagtttaagctaccaggacgctaacacttcgtgtcttcaccaggt
aacgtgcttatcgaggaattctcgagtcatctcctcattctgcgctatattctccatgtacgtgtcccgatccatgtgccacggatcgggtacgtctctt
gtgaaggcgcaaagcactccctcgcggtctttgacctgtgggaacttctccgccaccttgtaggccatgccacttgccacacacacgagatagtcggcct
tcatgcacatttcctccgtaaggagctgcgatcggtgcttggataggtccaattgatacttaagcataacgtccactgagtgcttggaagcaggcgaacc
ctcgggatcaaacacgtccgtcaaactggcgcattgatcacacaggatatcaatcggttagacaccatgtgggaaggagaagtctggtgtacgtacgctg
cggagcggatgacaatgcccttctcctcttgctgcttgcgcgacatgttgagcttgcgccgaaagtactcgacagcgaagtgctccgccactggcgagcg
acacgtattgctcgtacacacgaacacgatgttcatcctcgtccactcggcctgccgcctattttgatttgagagaccttgtaagcgcgacccgccgatt
ggttggtgtaaaggtatctatctacatttacggcgctcttgcaagcgcttgttccggtatcttcaagcgtggtgatcgcatacgtgcggatttgtatcat
cttccgaagttactagctgccacttcatgtgaataatgctgaacaattcctgcctacttgcatgatgtattttgtgcaaatgtgctcttggtccagagga
tctggctcgttactgcttggcgtttggcctacaagaagtgctgaacaaccttggcgtacgggaacggccctaagaactcactgtgattctgctgcttggt
agaggctttcaacagcgagtaatcgaggtccgggtacatgtccttgttgacagcgtacgactgtgggtcccactcgatgtcgaagctgttgacaaagaaa
ccctggaactgtgcgatccattggcgcagcgccacgtacgggatgaagtaaaaaccgcagcggtcggtatcgttctccttcgtttcttcctcaatgggtc
ccagcgtgagtgcgatgtacacttccagcatgggcgggagacagatctcgcgcgccacgtgctgctcttctgagtactcccacagacacatgacagtcat
gcgatcgccccaatccgttgtattgcgaacgaagtaggtgaagtctccatccgtacggcacaaaactgggtccttacacttcaagtgtagtggttggatg
ttgatatcggcaaacagcttggtttcttccgaaaggcagtctttgaccccctcattgtactcatgggtctcgtttccttgctgtttggctgagattcctt
catttccacactgataccagttgaatgggctacattgtaaggagaggaaaaaaacagatcgcttagccagtaaccaagacatgtaggcagacaggtaata
ctactagcgtacttgtagctgttggggcaaactgaacgctcttcccagtcggaaacctcctgcatccagtacgcaagcgagtggctgccctgggtaggcc
catccgcccaggagttttttacaatgagacccccggtgaagccttcacgggtcaaaaaggcatcattgtagccgacaagaagctacaaggcgaatcacca
acagattatcgtcaaagcttgatccaacacactttcatataaaaaacttaccatagcgtggccaccttcgatcgacatgccccggtggctaaagaactct
ccctccatgttacggtttcgacctcccttcagtggaatacaacacgttgtcgttgccatatctcctgggcacaaggtgcacgtctcgggctgacaatggc
ggtcgttagcgaacgcaccaatgcatgggtaatagtgcgtggtcatggcgatcggagtggaaagcggcatcgcctgattcttgcggacgagatgctctct
cacagacatatcgtcgtatttggtggtcatgctctgaaaaacaaaaggaatttgtaaattttctttctacagcagaaatgatagcatcgtaccgtaagtt
gaaacttcagcgggtttccagctgcctgtgcggcttcaaggcctggacagagagtgtcattgccaggatctgtgtagtacttgcagacagattgcgggaa
aatagactctttaagcccattttgaagataataaagctcaggaacctctcctccctcggtcgagttcatccacatctatggatgaataccagtcaatcca
gacactcaacaatattcaccgtgaagagcacaactaacctcgtcaccagccactctacaggccttttgttgctcggaatctgcatcaccggcgcaaagtt
tgaggatttcgacaccataagcctaacaggatacacaacagtcatttatactggcaacctctcgctcagtgcttcactattacaaacctgctcggagaat
gcaacgtattcgtccggtttgagccatcccttgtggataccgtgcgctcgatacgactgctctaggaagccgatagtagcaaaatcccagcaagtgccgc
ggtaagcctggtcctggcgcggcgttacgtgatccactgcgaacttcgatggcaacagtgccatgggaagcaacccgtttttcgaaaggtagtgcacttc
cccagtattgacatctttccgtgcatccaccgtctcctgttggacactattcgcactgtgacaaaaagagttaaaagacccatccaacccatccagaaag
ttatcaatcagccttttgtcgctgcacgtacacattctgcgtctccagccgtgaaatcgtgttgtgcatcgaaacgcatagagaaagcagcacgaggagt
gcgacaccattgagagcgtaaaacactgtccgcaacggcatcccggtcaaagcgttacgcttgtcagggattgtaaactgtggtaattcatgctcgttct
tgtcagctgtagacatcgaagcgcattagaagacatggcaatagccagaggcgtcagtggagcttgtcacctctagcggagccgtaacgaagcaacggac
tgcggtctcgtgggcccatttgaacttgcggtggaggaggcgcgatcacgaatgcctgttagatctgatcggtgatttcgagacgtttctgaacaacgga
ttgccaatcaagaaaggtttcattaagtgctgatttttagcttcacaagtaggttagtactatgtagcattgctagtctagaaaccttcgccaccagccg
tggagtcgtagatgctcatgatgttggtcatgaccgaccacacgggggcaaacacgaggtagatcacactattgacacccatcacgtagctcgaaccgcc
aagacgcttcatcacctgtgtctgctcagcatgaccaggaacacagaacaagcgtacgtcacgtcctgccttacttcgtgggtgtcgttctacgtcaata
aattccacatgctatcaacgccgggtgatagcagcggtgaacggagtccagaggttgtaaaccgtcgtgagagaaccatacatggctccttgtggcctta
agacgagagctctacgataatgaaagcgatatagatgattcctcgaggaacttagggattccgagccagaaccaaggcgagcgagtgacatcccatccca
catcttaacgtgcagtcggctctcgaggcatttcgtgtagagtttgtttaggcgtgtgccgtagtgagtagtttaccgatggcgtcccctcggaatcgag
tattcgcctcgcttagcgaaaacgaaccatgggaacatggtttacgcctcattgaatagctgacacgtaggaggtcatatcctagaacccagattggatg
gacaacgcgcgcagcaaaataattgaaatcgccattggggtggatttggtgggttttaatttcgagacgatctatgtgtgatctttttgtgtaattctac
aatgcgatgaagtctgtttgaggccgatgattaaccatcataagctatctgaacactggccgcaacgacatcaacttcaattaacgtactagatgctatc
tagctcacactgctgctaacgtaagatgcagcagctttgaaatgggtgactgactcctcagatcacatgtgatgtggggtcagtaggcgcacacatgacg
ctgccattggacgtctaccaaaaatgcattatgtacctagcataaatacaactaataaacttgatatcgtcgtgagacggttttttcgtctcacgagatg
aagggtcgcttccgtcgatcgacttatccagtcacttggttttagtatgtggtgcactttttatgtgtgatttgtaataccttggaaaacctttcacata
tcgagacctctagacaatttatatttagagacaaatttagagatgcaaatatggtgggtacataatgcatttttggtagacgtccattgacagcacatta
gatgaagagccgacgcagtgggtttccattctggagattcggtgggagattgttcggtcgcgctcggtgcactcttgagtcagtgaggtgataggtcacg
gtgaggtattgctcaacattgttcaccaccggaatcgctgtctgcgcggcattctgcaagaacgtatcattttgtagggagataagcgtgcccacaatag
cgaggaactgttcctggttatttggtgccagcatcacatggccacagcgagcccctgcatctggttggagtctgtagatgatatcgtctatcaatgagct
ggccgtgatacggcctggtcgcgttcgcaaccatggtggtgcttcagctgtaggcaagttgttcgccgcagccacgaacgcgttcacgttgtcctcttgc
cagtcgaacaggaaagccggatcgtcgtcatcgatctggatcgacgacaagtattcctcaagctaccaaaacgcaatcagcatcaagatcgtgagcctga
taccgcaggcacaacaacatacaatatacatcactcaccaatgggattgccgcgcggaaggaaaagacgtcgtacagcctctcgtcgaatacgtcaaccg
acggtggcacgcgcgacggcggatcggacttcattcgcttggccttttgttagccgctggcgatgtgcgctgagcgatttggtccgcccatagttcctct
ttgttgtcactttctcagattgaagtgaaaggatcattctcacgtgatgtgtaccacatacggtatttatatcgtaccaatgcgcgcataattaaacccc
cgttgaatcggatcaggttcaagtagaatttgcactaacaatgctctttgattataactaaaaatgctcttcgattataataatgtatatcctgtaagta
taaataaacgtttttcgttgtgactcatccaggtctagggttcattcaagcaacactcacaacagattgtactgtagaaattaataatttgttgtcgggc
tcattcaagcatgcgataaaagcaactgtgcggaaaccgccctgaaatcttgtcgataattcctttccctgtgaatcggatatttctgactccctctaca
ccacagctcacattccagaagtgttccattcctgactgctgttattcgcattccgagcgtgggaatcgaaggtgtattagaaatcttccggggtcagaca
cctcgggaccaaagtccaaacaaggccctgtgaccgcacctgtatcggcgacacttgccaacttactccaatctgaggctactctgtaagacatcagagc
aacgtatcattccacactggaatggtccggcagaccgggttggcatacgaccagtcccccaaactacccaagtgctgaaaaggggtctgctatcgttacg
catcgactcgtcactgaatactaccgcggaaggaaacatttcggtattagagaatatacctgcatttcactcgagctctttgttttctcctgtcactttc
tcagatgattctttcacttcagattctagttggaacacgttggagtccgacggtcggacataattctgtctaacattttttgacctcttactgtctcaac
agttctgtgcagcatgaactccaagaacacgataaagaccttgcagaagttcaggttcttatggtaccctggctcacgattgcaggccgctgaagggagt
agatctacaacagcatcgtcggttgtgtcgagatgccccagcagtttagtaccggtggagcatttgttgaagaaggaggattcggaccaggatctggtgt
acaccggcagttgtgacctgtaggagtgacggtcatggctggtaattgcggatacaatctcactctatcttatgcgtacttaacctcagaggcgcgtgct
gcgatcgaccaggaggtcgacttctaacagccatgtgaatgtggagctccacctagtgccttgccgaatagcaggcttgaagtccgttttaaggctgtaa
aaatattgaatacttcatctgtcctgaaatataaggccggtcccatagttaaacatgtccagaaatataaggccaccttgatattaagtgcgatttgctg
ttgggttgctacaaataacctacccttcgcattctcttaaactacggaatcacagtcaagcttttgaggaagcaagccctgaccgatgcattgttctcca
ggcacccctaccgaactggtcgttcttggctccactcaagccggttgttactgctgatgccaactcggacgacacctgcctcccattgctgtcggctaag
atggcatgtttcgtcttgagacagtagaaggtacgcttgttatccacgatcagatattcagatctccgcagtaggaagaaatagcgaggagcacgctgcc
ccatagtaagcgatgtcttgattgtttgagatcaagtgaccggtataattgtctgagaaaggtgggcgtcacaggttgcttggggagtgaaagccgcttt
acccctttgagaagcagtagtctaggaggtaacgaaatgtcgacgtcaccaaaccggtgttggtagcacaggacacttgacaattttcctcaaatcgtgg
cgtatcgattgccacggcgtgacttgtttgaaccatagcgccgtagatgcgccacgaagtagcgtaatttacgtgagttggacctccggtcgtcgctaaa
ccacggcgagccattatccgagcaaaccagcaccattgtcgccaggttgagctgtacttggtcttggtagtgtcagcaagggcgtcaccgagcagtactg
ttccaaactgcgcagcgaccgttgaacggcttgacgcattcagtaacagtacacagcgttcgggccacccccaaggacccatccgttcccggaacgcctc
ccaccagcaccgcagagttatccccaaccgccccacgaacatcagcgtggataagagcttaattgccaggcaatagacacacaaatggagccgccgtagc
cgcgtcggtttcttccactcgtgtgccacctagcggaagaacctctctttcatcatcgcctgttcttcgagattaattatcgcccggaacgcctcgagag
aatccgtccctagaatggcgtcgatgtacaagtggtccagaactaagaaagaaagcgttttctctagtatccctaacgtcaccggcaagtcaattatacc
gcttacgcgagtggcatggtcagggacactattcaagctgccgtgatacggtctcagaggctcagaggcacgctctagccgcttcagcacccgtttatcg
accaggctagcgactgctctagtatcagccagcatttgcgacgggcaacagtcgatgaagccactcgaccacgctttaattcttccaacgctgcatatta
ctcccttaccctccggtacgacgcgctcatccttagccgggttcgactcggccaggccaggtcgtcgccgtggcctcggggccctttgcgtattagcctt
aaggacatcgggagcatcgtcggctgtttcagatttcactggttcgggtgctttgatcggcatctcgaaaaacaccctctttggagcgctggctccaacg
gtcgcgattactggactatctccctcaatgtccctcctccatcccttaattaataccctgtcccggatcacagaggcttctatctcgtggcatcgcttag
cccacctcaaaatttggtccaagaacgcctcactcagcgttctgccaattctagcaggtggtttcgcagcgactgagtgttcaatccaagtccttccttg
tcacgcatgggagtaacttcgtccccaagctcttgttcttcgataggtggaccctctccttcgttcaaggtccgtttcagaggctggtaaatccacaaat
gaactgtggaacgccagctaaacaggggcgttctaatccccccggggacctcatctgccctcacgaggggtgggggggggggggggggtggggtggggtg
gggaggaggggggcacaaacttcctcgagaccattgaacacgttccgcatgaactcatgttccgtagtgtctcctgctagtttctccgaaaacaatgtgt
tctccatgctcgctgacacggaatttaccacaccgggctcggcggcgtactccctttcgccttctcggaagtccctattaggacgcctcgcctccagcaa
agcattcctttagaagttcgctgcccttggtgacggcgatcgtcctagtcccgcgaggaatatgagttggaggagttgctgctttagtcgctagggttgg
cggaaaccctttcttggttggctgtgtattgccaatcctgtatacattccgaaccaggagctgcaacgctagctggaccttcgtatagaagcgatccgtc
aacacattatggtagacaccttcttctggggcaggaggaccttcgtgcatattacggataaccgttgcaggaccagagttcgggtctgctgaaaatcggg
tcgttgattgacctcccagctcgtctgagtgctggttggccccgcaaaatacttgatgcagcacaattcaatacaggtagacaaatacaacatgtgggac
ttagccaaaaacaaaaataatccacgatggaggcggtcgaactgcgtaccgtagacaatagcagcatgtcataaacaattttgtgcccaatttggggggc
ttggccttcataaatcatttgggcgcgctgtgacgacttcttgatgggatcatggcctcgtcgaacggcaaaacgggagaaacgttgtatccccttgcaa
gcgtctgctgttgcgtgtccactacggagcggacttcccaggtgcggtccgtttcagtcctctagtccgtgttgtcggtaaaatgctggtttcgcatgat
gcggtcaaccccacgaagtcggcaaacgtgccggtttggacggcgcctattggatcgttccccagtgatccgcacaacagtacattctacaacatatagc
acattagtttcatgttgtatacacatcatctcgcaaaatttaccaaactcacagccatccactcgcatctacttgagatcttcatcaccctgcgcgagcg
cttgaatctgtttttttgtcagcgagtccctattgtttgtggttgtgttccagccacgtcgctgctgcttgcagacgtcgcttctcctgccctctttggg
ctttccacttgtcgcgactgaggagcgatgcaccacccaaactaccatcactatcacttgaaagatcctcatctgcatattcgtttagcaggtcgttgcc
accatatgagccgctctgggaatcgtccgtgtgctttgcacacaagtcttgctcctcaatataccagtcatccggaccttcgccttcgtcgtccaaggcc
gtgttgagagctccattatcataatcttaaacggatgcactcatagctggaacggaaggtgcgagtggctcagtcgtatccatactcagaaccctagatc
acatgacgcgtcaataacttttatgcgttcacacatgcagtatatatatcatagctgaagttacctggtcgttgatatctgattagaggcagtgttgtgg
cttcggctgatactggtggtgatctgaaacaacataacatcagatacaccatgaatacaaatttgttaatggggtatgtacggcatgtcgagaatcacat
accttggtgtagacaacatactctcgtcgtctgaatctgaaccctcaattggttcagcaaggtgcggactggtggttttcttctgcttctttgctgcggg
agactttgtcaatgccttgtgccttgctgctgcttggcgcgctttagccaagctgcgttcttcgtcgaccacgtgcgcacgttccgtcgctttctcggca
tcacgtcgtgcagatatagaccacacgggctaccgcttccatttccttgaacgcgttcctttccttctccaaagcttcgcgatgtaccttagccatcttc
tttttcccctttccagtttttctttgttttggcctcaattgcgaggcgtgcttcccgcagcgtcgtcgtcgctgcaatgtacaacgccgtctttccaaca
ggtgaccgtctcggaagcgcaggaatagatcgccgacgagtcgcagctgtagccgtcgttgcctgcattaccttcgtcgcttgcgcggccttcgtagctg
gcgtgcccccgtagccgtctgcgttgtccccgcgatctcgttccgaagtcagcatccgtctccctctctccgttcaggtatgctgtgagttggatagtca
agcgcgccctatcctccaagattttgccatccaggcgggcgaagaaggctttttaactcgtgacgcgttttgcggcggccaaccatctctggcccacttt
gctttttcttgaattagtgaaaccagcgcctgtcggcgggttacacgaggccagggtcagtaatcttttagaaaacctgagggttttgtgtgcgtgctct
gtgcattttagcctagccctgcgtatttcagtgtctttaacatgcagtatttactacatgtggaaaaagagtacgtggtgcaccttttgggcacatgccg
ccaaatacaaactataagtgcgaggggggggggggggggttaacccgctccacatacacacttacggcaaattttgccccctgtacaaccccacatgttg
tgtatactacacatgattttttattacacctttgtaagtacgaaacagttttctgtactgcgggaagattgtgagattggtcatgcattgattgagaact
tcctcgcagcgctatgcatcagcatgttggagagacacccacgctacaggaggaagttctgacagggcgtgtactagacatgatttgagtgcccctttta
cagtttttgaaccagctacacccaaaattgtattgactatgcttgaacactgcgttgatggcaaagaccattgtgttatgcacgacgaaatcgtacattc
ttgcaaaacaaaataaatagtaaaagcttgcattcattcgtccgtatatacgtccatacaacataccgcatgactcgaatacgcggtcaattttctcgta
aggaagctcccggaaagcatcaatgacgttgttcactaactcttcaatcgtgcgggaggttttgcgatgctgcagtgtctgaagcaacgcaaagaagccc
aggtctagcacattgtagtccggcgaattagctggttgaacagtgagggtcatgccccaacctttgtcagtacagtctgctatcacgaccacattatcca
ataagacatgcagtctcgcgttgtcttgttgaaggcagacgcgctccccagacagccatagtcgcttgatctctgggatgaccgagtggaccaggcaagc
atggtaaatgtcacgatccacagtatttgttttgagctcaagcgtaccagcgactgtgttcttgctcttttgctgcggggtaggttcatacaccacaata
ggccatgtgcctattttgccatcccagaccgtgttctgctcagacacccaccgcgggcatacactcgcgacgagaaacattaccttcacaacaaagtttt
gttgtgcacggtaatgtggggagcgggcccgtctggagcaaagtaatagcgggagttctcttaaaaaaaacatttttcgtccaaatgtacgtaatctaga
agagagtcaaattcatgtctgccacgagcagaaggttccacaaaatttagcacaaactttatccttgcgacgcgctgttcgtccgtgagttgaggtttta
gtcgagcatgatgactccgaaactacccagattgtaccacttattcatcgacacttcaaacggcctgagcgcagtttttcccgattgagccaagcgagtg
gtgttgctttgcagaacacgaacactactcgacacgaagtctaggctgtgaacaataccacctcgaggtcctgttaaaaacatgaacatttatatttgtc
agtgcgaataaaaatcataacaacagtaataataactatatccaacgtacgctgcatattgcggtttgatgtatataaggccgtcaaaccactctcgaac
accgaaaaggttgacataatgcccttgtagagcattcgaaacgggttcaacgtccgtcaagcctttgagaagagcgcgcatacgtagttaaacttcggtg
cgttatatttatttgtttcatttttacttcctctgtcctgaaacatacggccactttttttttctaaaataaatgttagtgcttacgcatcgatttgatc
aacgttgattcgttcaaaagaacctccaatcggcgcgtagcacgttacagtttgattcgctgcaatagccccagtggttctcgagatttagacgtctgaa
gaaatcattattttggacaagcaacatgactgttttagcgcttcctgtccctaccaagcgcaagaacctgacaccgaaagagcgagagtacgctctattg
ctaattttacggcgtcgcgacgaacattacagtaccagccaagatctactcccgcgtttcgggtgttcggtgcgccaaattcgtcgtctgtggaagaaat
ctcgtggtgcggtgaagaacggcaagttgtgcggggtggagagcggtaggaaggggcgctgcgacagaacgtctcgggtagagggcgaattcccccgaga
gctcgcagtgaagatcgcacttacgccaattcatctgcgaaccgaccttcgaattttagctgtatcgttaaatatacactgtatgtgtaccccagctcgt
gaagaaagggtagggccatttgttgagcgagtggaaaagcgcaaacgcctggaccagcatgagcagcagtacacgtttctacgtagcgcaccacaaacct
ccaacatgatggagaggttattcagcattgcccgtgcaacgttcgtggcacgagcgcaacggacttcaacgcagtacactagagcaaatactcttccttc
gccagaacctcacctactgggatgtgaatactgtagatagcgctcatccatagcttgcgaaatggcattatgcatgtttcacatttttaaaatgtcatta
ttgatggcgggcttttgctcgaacagatacattatttattatttaacaggtttgtcaataaatatgcatgtcataatcgatggccctggttgaaagcatt
gctgacactcagcagtatagctagggctggggtaggcgtcgagaattttcgaaacctggtcgggtgacacagctcaggcttcggtctttcgcccctaaaa
cataacccgcagggccaacgcaccagcggcgatagcgcatcaattctaggcgcgggttccaaaagaattatggatatcagcgagccactcgatcttgtta
aagactgtaatacttctttgtctccatcgtgctctcggccacactggtgatcacgtctctctctttgttgggcactccttcttaaacgccacttgtcgac
gagacatgtgaacctcgcaatggtgagctcgtctctctgtttgctaggtgattctatttacacgtatcgcttcggccaaatcaccactggcccgattgct
tgacaccttttgaattctgctgctgtttggcttatatctgccttgcttctgctgtagtttcctttttccttgattctggtttgcttgacttgcttcttct
gattacatgaagaacaaacgctggtggtgtgctctttagttgccacattctcgtcgagaa