Description :
From Genome Similarity Track
Location :
contig_21:659285- 660461
Transcript NameFunction/comments
g3956.t1hypothetical protein PPTG_05708

Sequence
1176 bases(100 bases per row)
ACGAGAGTGAGGTAGTTTACCATCTCTTCCTTCGTGTGGTAGAGCGGCAGGTCGATACGGTTGAAGCACGTGTGGCCCTTTGGCATGAGGCCCGTGGGCG
GGGCCCCACGCTGCACGAACTGGATGGTAAAACGACGGACACGTCCATCACTGCTCATAAGTGCCTTGAAACCCTGAACAGGGACGCGAGACGTGCCGGT
CGCGAACTGCAGCAAACGGGCGCGCTCCTCACTGGTGAACTCTGCCATGGACTCCCAGAACCATTTCAGCACTCGGTGCTCGACAGGAGTCGGCTTTTCC
AGCTTTATCCAGCGGACCTCACTGTGCGTGTGCCAGTCGTTCACGTCTAGCTCTGGCACACCAGAGAGCAACAGATCGAACTCCTGATAGTCGAACACCG
TGATCAGGAACTGTGGCATGACATCGTAGAAGCCCATCAGCAGCGCACCAAGCTGTTCCGAGATACTCTCAAACATGTAGTGTTTCAGTAGCAGCTCCAG
GTACTCCTTTTTGTTGTCGTCCGTGACATCGCGATTAGCACCACCTGGAACCAGCTCCATCGTGTGTGACTTGCCCTCCGAAGTGATCACCTGCACCGTG
AAATCGATAGCCAACAACTCAGCGTGATCGTTCTGTTTCATCCACATCGCATTCTTGTACAGGTCTTCGTCGAGGAACTCCAAGTCCGAGAACGAAATGG
GCACGCCAAGAATGTGCTTAATGAGCGGAAGCGCCAGCGACATCTTCATGTTGTAACCCTCAATCAGCGCCTTGGCCAGCAAACGGCCTATAAATTCGTA
GTACTCCAGGTGGTTCGGCACCTTTGAGGCCGACGCTGGGTTGATCCAGTAGCCCATGTTTTCTCCCTTCGTGGCGATGAAGAGACCGAAGTCATCGTTA
AAGAGCGAGTCACTCAGAATTTCATACCACTCACGAATCAAGCCACCAGCATCAAGTCCAGGCTCGTTCTCGAAGTAGATGCGGAGACGCTCCCAGAAAC
GACTGGGCGGACACTTGAGCATCTGCTCGAGCGAGTCGCTCACCACGTGCTCCCGTCTTACGACGAACTGGATGTGACCCTCCTCATAGCTACGCCAGCG
CTTCTGCACCTGCTCAAGGAACCAGCGGTTCTTGTCGTGGAAAGTCAATGAAGCAATTTCTTCCAGGTCGTCCTCA