Description :
From Genome Similarity Track
Location :
Scaffold_17:659255- 661380
Transcript NameFunction/comments
Physo_131838hypothetical protein

Sequence
2125 bases(100 bases per row)
GTTCAACATGGACGAAACAGCGTTTCAGACCAACAAGGGCTCCAAGCGTGTCGTGGCGCTCCAAGAACGTTTGGCACCAAGACGTTGCGCTCAATTTTCA
CCTCACGCTGGTCGCGTGTGGCAGCGCGTCGGGGTGCATGGTGCCGCCGCTTTTCGTGCTGCCGGGGTTGACAGTCAAGCTCGAAGTTCTAGATGGCTGC
GCCATACCCGGAGCTGCCGTCACCACCTCGAGCTCCGGGTTCATGAATGGATTTCTCTTTCTTGAGTGGCTGCGCTTTTTTTTCGGCTAGCGTGCCCAAG
GACGTGCAGCGACCTCTTCTCCTGATTCTGGATGGGTGTTCGTGTCATTACTCCGTGGAGATCATCTTAGAGGCAGCTCGGCTTGGCGTGCTTCTGTTGT
TACTGCCTTCGAACGCGACCCACCTGCTTCAACCACTGGACGTCGCTGTGTTTTCGTCGTTCAAGGCGAAGCTACGCCGCCTAACCGAGATCTACGTTGG
CGAGACTGGACGCAATTCGGTCGACAAAGAGGAAGCCATCCGGATGGCAAGCGCAGCATGGGTAGGATGCAAGATGGGTGAGAACGTCAAAGCGGGGTTT
GCTGGGTGCGGCCTTTTCCCTCCGTCCAAGCCTCGTATGGACATGCGCATCGACAATTTCCGGCGCAACGGGACCCCCGCATCTACGAAGCTGGCAGCGT
GGCTCCGGATCGAGGTCGTGCAGAAGGAGGTGCTCGTGCTACCGCCGTCCAAGAAGCGGGTGCGCAAGACAGCAACGGTCGCCGGTCGTCTTTTGACCAA
GGAAACACTGGAAGCGATGGCACAACCGATGAAGAAGCCCAAGAAGGCAGCCAAGACGAAGAAGCATCCGATGGCAACGAAGGCGACGAAGATGAAGAGG
GTGCCGTCTCCGGTACCGGAGCCTGTGCAGCTGCAGTTCCAGTCTGCGTCGAAGCACGGTGAGGCAAACCAGCAGGATAAAGTTGTGTGGGAGGCGATAG
TTTAGTATAACCAAAGAAAAAAGCTTTTGCTGGGGCATTTTCCACCACATTGTCTTCATTGTTTTTGTTGTTTATTTCCTACTTTCTATAGTGATACGAT
ATCCCTCTGTATGCCTGGGCCCGCTGTGATGTCCGGTTTTTGAGATTTGACGATCTCAAACCGTTATCAGAAGGGGAACCCGACTCATGGTATTTAGCAT
ACTGGCGGTCAATCCGTTCACTCGGTGGCAGCCGTCGGTCGCTTTCGCAGTTCTGTGGCAGCCCCCTAATGCTCTAACTGACAGTTAGCCCACTAGTGTT
TTGGTTGAGTTAATGCTGCCAGGTGGAATCGAACCGCCGTCCTCTCGGTTATGATCCGAGGACTTTACCACTAAGCTATGGCAGCGCTGCCTCTGAGCAC
AAATCATACTATATTTATACACAAATCACATAATATTGTGTACCATATTGTGATATCGTATATCCTGTCTTATACGATTTCAAATGGGTGCAAATCATTT
TGTACAGGTTGTTTCGGTGCTGTCATGAGAGCAAAAAGAGATTTGTCTCCCTTACAAAACCACAGATAAAATGCGGCAGATAACTGGTCCTGCCGTGAAT
GGGTTTGCAAATAGTCAGCAACTCCTAATTGAGCTCTCGTTTACTGTAGAGCTCAGTAAAACAGTCTGCTAACAGAAGAGATTGCGCTCTCTTCAGATAT
GCGTTTACATCTCAAAACTAATTGCCCAATAAAAATTATGAGCAAAACAGTAAGCGGGATTACATTAAGGCACACAAGTGGCACCGTACCTTACACTCCT
GGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN