Description :
From Genome Similarity Track
Location :
contig_27:659229- 664316
Transcript NameFunction/comments
g7068.t1hypothetical protein

Sequence
5087 bases(100 bases per row)
TTGGAGGGATCGTGGGACGACGGTAGCTGGTCGCCGACGTCACATTTACTAGGGGGCCCACTCGCTCCGTCTCTAGCGGTCGCAGGAGCTACAGATGAGG
AACGACTCACGCCCATGGAGGTTTTCTTCGGAGCACGACCGAGAAGTCGACGGTCACCAGGGATTCACGGCACTTCAGCACTCGTAGCCACGACACGGGC
CGAGATCACGCTGTCCAACGACCAGCTGTGCCGCAAGAGCGCTATCTTGCGCGCCTTCGTGTCGGATCCGGCCATCGTGACTAAACGCATTTCGTTTGCG
CAGCTCCACTTTTTGAGGCTGCTCGCCAAAGGAGGCAGCGGGGAGGTGTGGCTGGGCCAATATGAGACTCGCTACGTGGCTATGAAGTGTTTATTGCCAA
CGAAACGAGAGGACCCAGAGGCCTTGGAGCAGTTCGCAGAGGAGATCAGGATGGCGTCGTTTTTAGCGCACCCGCGGATCGTGGCCTTCTGCGGCGTAGC
CTGGCAGTCGCTCTTGCACCTTTGTGCAGTGACGGAGTACATGCCACGCGGTGACCTAGAAAACCTGCTGGCAAATCCAATTGCTCAGAAGGAGCTGAGC
TGGAACAGAGAGAAGCTCACGCTGAGCAGTGATATCGTCGAGGCGTTGGTGTACTTACACTCGCTGGTGCCCATCGTGATTCATCGCGATCTCAAGTCCA
AGAACGTGCTGCTGGATCGGCGATTACGTGCAAAGCTGAGCGACTTCGGACTGAGCCGCGAACGATCCGTGGAGGACACCATGACCAACGGCATTGGCAC
GATCTTGTGGAGTGCGCCAGAGGTATTAGAGGGCAAACGCTACGACGAGAAGAGTGATCTGTTTTCGTTTGGTGTAGTGCTGTCTGAGATCGACACGTGC
GCGCTCCCGTACGGCTTCAGCCGCCACGCCAAGATGCGCAGTATGCAGGTCGTCCACCTCGTATCCGAAGGCAAACTGCTTCCCAACTTCCGGGACGACT
GCCCGCCAGCAATACGAGCGCTCGCACAGCGATGCCTAAGCTTGGACCCTGCAGCGCGTCCGACAGCAATGGAAGTCGCCTTCGAACTGCGCTCTTCCAT
TGCTCCCCAGCTACTGCAGCAGCCGATGACGGCACTGTTAGTAGCGGACGATGACGGCGCTGTTAACGTTAGTAGCGCGTCAACTCCCCTCACCCAGACG
TCTCCAGCCTTCACAGCAGTCGAGAACAGCTCGACGCCACCTGTATCATCATCAACCGAGACCGCAAACACGAAGGAGACCCAAACGGATCCGTGATCTT
CAAGACGAAAGTAGTCGCCAACGGTTAGGAACGCGAGCCTTGGCAAGTCGCGTACAGACCAACGGAAGCCCATTAATTTATGAGAACAAAGCTTGTAAAA
ACCTGAGACCGTCGCCACCCAGCAATAGCCGACTGAACATGCTGACACTAGCGAAACGGACGTGATCACTGTCTCGGTGAGCCTCTGGATGTGGAGGTGG
GAGACGTGGGTTTCCACACATCGATAGCGCCATGGACAATGACCATGAGCCATCGACCTCTAGGGCGCGCAAAGCCCTACTACTCCGTCGAGTACCGATC
CTGGCACATGTCGTGAAGCAGGGACTGTGCTCGGAAGGCGAGTTGCTGCGTGCATTGGAGTACGTGACGTACAGTGACGGAGAGTACATTTATTGCCAAG
GCCAGCCGGAACGAGACTTACTATTCATCGAGGAAGGCAAAGTTTTGATCACTCAGCGTCGGCGATCTCGTGCTATGAGCACTACAGGTAGTCGCCCGGT
GGGGTTTATTCCGATGGACAGCTCGGGCGGTGTTGTATCCTCTCGGCGGCCCTCACGACGGCGCTCGCAGATTGAAACTGAGATGGAGATCCAGCTACAC
AAGCACGAGGAGCTCGAATACTTTGGCGAGGAGTCTTTGCTGCAAGGATTGGTTTCTAGAATACTCAATGCGGTGGCTAGTGGAGCGGTGACGTGTGCCG
TACTCCCAGAGGCTTCATTTGCCAGGTTGCTGGCACCGGTACACGAGTTAATGCTGCATCGGCATTTGTTGCGAATGCACGGCGTGCTGGCAAAACAGCG
AGTATTCCAGCACTTCTCCGCTCGTCAACGACAGCACATTTTGGATCGTTGTACTCTAGAACACTACGAGGAAGGAGCTCGAATCATTCAGCAAGGTGAT
AAGATGACGACCGATATTTTATCTTGGCCGAAGGGGAAGCTGATGTTGTGCTAGATGAGCCCTTGCGAGATCTTCGGCCAAATAATTATGCAGAGGGGAT
TGAAGGGTTTGAATATGGCGGAGAAGAAGAGGACGGTGGGGGCAGTAGAACATCGATTGTGTGTCGAAAGGCGCTTTATCAAGGATTTGGCGAGATGGGG
ATCTTAGGCCGGCCTCGAACAGCGCATGTGGTTGCTGCTGGGAGCGTGGTTTGTGCAGCGATTTCGCGAAAGACGTACGTTGGCGCTTCGCAGTTGATAG
GCGTTAGTGGCGTTGATACGGACGCGGAGGCACTGCTTGCTATGTCTCTGATGGAGGAGTGGGCCCTTGTGGTGAAAACTCGGAGCCTCCATTTGGCGAA
CCCGTTGGTGTCTCGACATCTTGAAACCTTTGTGAAAAAGTTTAAGGCCGCCTACATGCAGAAGTTTGAAGGCAAAACGCTGTATCTAGACCTGCTCCGA
CGAATGCACGCAGAGCCTTCACTTGCCGATGAATTCCCGTTCGTGTCGGACCGAGTGGCTTGGGATGCACCAACATCATCGCTCAGTATCACGCGTGCTG
AGACTCGACGCGTGCTACTGCTGCCTCCGGCTGACCGCTCCCCGTTCGAGATCAGCTTCATGGCGCGCTTGCTCGAGCCTACAGCGTTCATTGGGAAGTT
TGACCGGCCAGCTCATGTCGATCAGCTCACGCTCGCTCGCGGGATCGCTCGATTTGCCTCGTTTGCCACCATCCAAAAGGACAAACACCTCTTTCGTCAA
GGCAAGATCGAAAGCCGCGCCTTCCTCATCTTGCGAGGCAACATCAGCATCGTGAACGAGGACGTCAGCACCATTCAGACCGGTCTCGCCGTCAAACACT
ACGACGTACTCGCCACACTCTCCGCCGGAGACTCATTCGGCGAGCTCTCACTTGTAACGCGACTCCAGCGTTCAGCCACAGCTCTGGCTGCCTGTGAGGC
AGATTTGCTGGTACTAGAGCGTCCGCATTTGCAGGCCTTGATGGCTCTGCTACCAGGCGTATCGGTGCAGCACGCCATGGTGGAGCGCGCCGAATTCCTT
GCAACGCTCAACTTTCTCCGGGACAATGACTTCGCGCAGTGCATTCGCGTGGCGCATGACCTCCAAGAGCAGTTCTACGAGCCACGCCACCTTTTCCTCC
AAGAACCCGTGCACTTGCGTACGCTTTACATCGTCAAGAGCGGCGAAGTAGTTGTGTTTCTGCGTCGGCACGTGCCAGTTGCTGAGACTACAGGGACCTC
AGGAGCGAATGACGTCGCACCGACCAAAGAAGTGCTTGTCCGAGTGGCAACGATTGGACCGCAGGAGTTTTTCGGTGTCGCCATTGCCAGCGCCAACATG
CTGTCAGCGAGTGCATCGGTAGCTGGACCGATTGCCTCGACTGGAGCGTCTGCTTCACCTACCAGTCCCAGTTCTGGGGCCGCTTCTCCGTCACCGCCAC
CTCTGACGTCTCCAGCATCTCCTGCTTCTCCCTCGTCGCCAGCGAAAGCTCAGCTGTATATTGCCGCTACTTTAGCGTCCGTGACGACAACGAGTGGGGC
TTCGTCCACCACGGCCAACTTTGACCTGGCCAGAACTGTGTTCATGTGCTCAACACAGGTGCAAATGCTGGAGCTCTCGGAGCGAGGCTGGAGACGTCTT
CCACTGTCCAGTCTGCACTGCATTCGGGAGTCTCTGCTGGAGCGGCATCGCTGGAACCTGGAGACAGCAGAAAAGCAAAACCAACAGTCCTTCTTTCTCG
CAGACAAACCCTGGCAAACAGCAGCACGGCCGACCACTTCCAGGTCGTCAAGTACGCCTACTACCGACAGCAAAGACCCCCAAGCCCGAGCACTAGAACC
CGTACCAGTAACGCAGTTGGCTCGACGTATCAAGGACAAGAAGCAGCAGCAGCATCAAAAAGGCCACCAGAACGCCGTCTCCCGACTCTTCTCTCCTGTT
TCAGTGGCACTTTCTCCGATCAAACCGAATCATCTCTCGGTTCCCAACATTTGCGTTGAGCGCCCTGCATCGACACTTTCAAGTCGCGGGTCGCCACTCT
ACAGTGTCAGTCAAGCGCGACCAGCAACCACAGGATTCACGTCCTCATCTCAAGACAGGAACTGGGTGTCCCCAGCTTCTGCTTTGCCATCGCCGCGCTC
GACTCAACTGGGCGGGTCCTTCCAACCGAAAGGTGTCATGATAACGCACTCGTCCTTGGCAGTTCTTGACCAAACACCTACCAGCCCCTCGACACTCAGT
GCGCTGTCTCCTCGTCCGCCCTCATTGGTCTCGCCTTCGGCCAGTCCACGACGAGACACTGCACAGCGACGACTGAGCTCAAACCCCAAGCAAAACACAG
CAAACTCCCCACAAACGACAGCAAACGACTGCCAGGCCATGTGGAAGCTGCAGCGCAGACCTTCCAAACAGTAGAAAGCCATGTTGCAGTTGCAGTTCTC
ACACGTCACAGATGTAGCCATCTACACGTTGAAGTTCGTCGAAGTCAACTTTTAGCCAATCATCACCTATTGCCTTCCATTCCTCAATTTGCGAAAAACC
GAACATGGCGACTCTCTCGCTGGGCGCTTGCGTGGCCGTGACGGAGGCGCTGCCCGCCCCCGCCGCCCGCTTCCGCCTGCAGTTCACGGACGACCGCCGC
ACCAAGGAGCTTCGCTGGGTGCTCTTTGCCTGTACGTTGCGCAACTTTTTCCTATTCAGCGCAAAATATGTTTTGCGCAAATTCTAATGTTATGTTTGCA
CTTTTTGCAGCGACTCAGCGTGGGGCCGTGGGGAAGCTCATCTTCACGTTGGAGAAGAACGGGACGGCGCACGTCAAGTCGGTGGTG