Description :
From Genome Similarity Track
Location :
Scaffold_3032:659- 2672
Sequence
2013 bases(100 bases per row)
CCTCCTAATCCACTCTTCCCCTGTGGATCCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTTCCT
GTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCAACGGATCCCCTTCCTACTCTTCTTCATAAGACTGCATCACGCCGAATCTGTTACG
ATTCGTACGATCCCGCAAGAATTCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACTAGA
AATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTCGAACTCGTCGTCTTCGAGATCCACATTCCAAC
TATCTTCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGGTATTCTTTGACCAACTACAGCTTGGATACGTGTACTACAGGGAACAGG
CGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCAAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTA
TCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTCGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCGGTATC
GCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAATATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTCCTCTTCTTGGTGC
TGCAAACTGGGATTGCCGCTTCCAGGGTGGATTTAGGATCCCACCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTTAT
CGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTTTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCG
GCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCT
CCCGATCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAAAACACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTT
GGCAATCACATATCCTGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATT
TGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCAACATATCGTT
GTACGCTCTTGAAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGT
GGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTGGTAGGGGGGGGGGCAATAGAAGA
GCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTT
TAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCA
ATCCTTCCTCTGGACCTAGTGACGGCCATCATTTGGACTGTCCTTTTCCTGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCT
GATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCCGCACTGGCATTTCAATCTCGCTTGACATGCAC
CAACTCGTGATTC