Description :
From Genome Similarity Track
Location :
Scaffold_31:65858- 67002
Transcript NameFunction/comments
Physo_134303hypothetical protein

Sequence
1144 bases(100 bases per row)
GATGGCGTACAGGATGACGCCGCACCCGATCATGAGCACGGGCGTGTCCATCGTGTGCGGGGCCGTCGCCTCCGCGTACGCCATGGTCGGCGCCAGGATC
AGCATCGACAGCAGCACCTGCCAGAAGTTGTCGAACGCCGCGTACTGCAGCGCCGGGAACACGAGGCCCGACAGGAACACGCACGCGCTGCCCTCCCAGC
TGCGCGTGTACTTGTTCTTGCTGAAGCAGCTGCGCGTCTTGTACTTGTGGCGGCCCCACGTGATGCCCACGGGCTCGGCCAGGCCGTCGCCGATGCCCGT
GATGAACACGAGGATGAACGTCAGCGCGCCCTGCGCCGCGAACAGCCACTTGAAGAACATGAGGATGAACATGCCCGGCGCGATGTTGCCCACGATGATC
CACTTGAGCGTGTTGGGGCGGTCCTCGGGGCGGTCCAGCGAGTTGAACTGCAGCATGAAAAACTTGGAGTGCTCGCGGATGGGCTTGATGAGCACGAGGA
AGCCCAGCATCGTGAAGAAGTCGCCCCACGCCAGCGCGAGCGGGCCCGGGTAGTCCGCCTTGATCACCAGCGGCACCATGTACGCGGCGAAGTGCTGCAG
CTTGCGCGTGTAGTTGACCTTGAACTTGGACGACTTGTTCGTCATGATGTAGCCCTTCTCGTCCACGTCGCAGAAGCAGCGGCACACGATGCCGCCGGCG
AGCGACACCACCATCATAACCACGAGCTTGGGCAGCTGCATGAGCCAGAAGCGGGTCTCGTGCAGCCACTGCGGCTCGTAGAAGTACGTCAGCACGAGCA
TCACGGCCGCGTACACGGCCATGCCCACCAGGAAGGCGAAGTCGAACGTGTTGTACCAGTGCTCCTCGTAGTCTCCAGCCACTTCGCCCTCCTCAACCAG
CGACGTCTTGATGGCGGTGATGGGCTGCAGCTGCTCGCCCGTCGCGCCGTAGGACGGCACGGGCGCGCGCACGGGCAGCGGCGTGGGCACGCGCCACACG
AGGCGCAGCATGACGTAGCACAGGATGAGCGCGGCGAAGGGCAGCACGGCGATGATGACGCCCTCGGTGGTGGTCATGTTCTCGGGCCACTCGAGCGGAG
CGGCCGTGGGCGCGGGGGTCACCACGGGGTCGACGGGGATCACG